ID: 973884475

View in Genome Browser
Species Human (GRCh38)
Location 4:55306616-55306638
Sequence AAGAAAGCACAGGCGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973884471_973884475 -10 Left 973884471 4:55306603-55306625 CCAACAAGTAGGCAAGAAAGCAC No data
Right 973884475 4:55306616-55306638 AAGAAAGCACAGGCGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973884475 Original CRISPR AAGAAAGCACAGGCGGAACT GGG Intergenic
No off target data available for this crispr