ID: 973884475 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:55306616-55306638 |
| Sequence | AAGAAAGCACAGGCGGAACT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973884471_973884475 | -10 | Left | 973884471 | 4:55306603-55306625 | CCAACAAGTAGGCAAGAAAGCAC | No data | ||
| Right | 973884475 | 4:55306616-55306638 | AAGAAAGCACAGGCGGAACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973884475 | Original CRISPR | AAGAAAGCACAGGCGGAACT GGG | Intergenic | ||
| No off target data available for this crispr | |||||