ID: 973885773

View in Genome Browser
Species Human (GRCh38)
Location 4:55319417-55319439
Sequence ACTAAGAAGAAAAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973885768_973885773 28 Left 973885768 4:55319366-55319388 CCTGGTGAAAAGTTTCAGAATTT No data
Right 973885773 4:55319417-55319439 ACTAAGAAGAAAAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973885773 Original CRISPR ACTAAGAAGAAAAAGGAGGA GGG Intergenic
No off target data available for this crispr