ID: 973893873

View in Genome Browser
Species Human (GRCh38)
Location 4:55393681-55393703
Sequence ACACTCCAGGGCTTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973893873_973893881 24 Left 973893873 4:55393681-55393703 CCTGTGAGAAAGCCCTGGAGTGT No data
Right 973893881 4:55393728-55393750 CAAAGCAGCTTTCAGCAATGAGG No data
973893873_973893882 25 Left 973893873 4:55393681-55393703 CCTGTGAGAAAGCCCTGGAGTGT No data
Right 973893882 4:55393729-55393751 AAAGCAGCTTTCAGCAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973893873 Original CRISPR ACACTCCAGGGCTTTCTCAC AGG (reversed) Intergenic