ID: 973894697

View in Genome Browser
Species Human (GRCh38)
Location 4:55399840-55399862
Sequence GGATCCTTGTCTTTAAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973894690_973894697 7 Left 973894690 4:55399810-55399832 CCTGCCTCAGCCTTCTGAGTAGC 0: 2887
1: 85071
2: 182808
3: 212496
4: 143787
Right 973894697 4:55399840-55399862 GGATCCTTGTCTTTAAAACTAGG 0: 1
1: 0
2: 1
3: 20
4: 222
973894696_973894697 -3 Left 973894696 4:55399820-55399842 CCTTCTGAGTAGCTGGGAAGGGA 0: 1
1: 2
2: 23
3: 561
4: 12405
Right 973894697 4:55399840-55399862 GGATCCTTGTCTTTAAAACTAGG 0: 1
1: 0
2: 1
3: 20
4: 222
973894689_973894697 10 Left 973894689 4:55399807-55399829 CCTCCTGCCTCAGCCTTCTGAGT 0: 392
1: 5972
2: 13874
3: 31033
4: 45483
Right 973894697 4:55399840-55399862 GGATCCTTGTCTTTAAAACTAGG 0: 1
1: 0
2: 1
3: 20
4: 222
973894688_973894697 14 Left 973894688 4:55399803-55399825 CCATCCTCCTGCCTCAGCCTTCT 0: 26
1: 905
2: 19753
3: 78111
4: 34290
Right 973894697 4:55399840-55399862 GGATCCTTGTCTTTAAAACTAGG 0: 1
1: 0
2: 1
3: 20
4: 222
973894692_973894697 3 Left 973894692 4:55399814-55399836 CCTCAGCCTTCTGAGTAGCTGGG 0: 3774
1: 101495
2: 206159
3: 237850
4: 152587
Right 973894697 4:55399840-55399862 GGATCCTTGTCTTTAAAACTAGG 0: 1
1: 0
2: 1
3: 20
4: 222
973894687_973894697 26 Left 973894687 4:55399791-55399813 CCTGGACTCAGGCCATCCTCCTG 0: 1
1: 160
2: 2665
3: 20219
4: 116908
Right 973894697 4:55399840-55399862 GGATCCTTGTCTTTAAAACTAGG 0: 1
1: 0
2: 1
3: 20
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973894697 Original CRISPR GGATCCTTGTCTTTAAAACT AGG Intronic
901289601 1:8113706-8113728 GGATCCTGGGCTTAATAACTAGG - Intergenic
901878328 1:12179654-12179676 GGCTCCTTGTCTGTAAAATGAGG + Intronic
902893450 1:19461821-19461843 GTTTTCTTGTCTCTAAAACTAGG + Intronic
905397011 1:37673245-37673267 GCATCCTTGTCTGTAAAACAGGG + Intergenic
905581886 1:39088516-39088538 GGATCCTGGTCTATAGAACCAGG + Intronic
905669641 1:39783078-39783100 GTTTCCTCATCTTTAAAACTGGG - Intronic
906469377 1:46114998-46115020 GGATCACTGTCTTAAAATCTGGG - Intronic
908253404 1:62283045-62283067 GGAGCCTTCTCTTTATAACAAGG - Intronic
908264623 1:62366062-62366084 GGATCCTTGTTGTTCAAACCTGG + Intergenic
909111342 1:71481971-71481993 GGCTCCTGGTCTTTAGAATTAGG - Intronic
909546816 1:76857458-76857480 GGTCCCTTGTCTTTAATATTTGG + Intergenic
912778362 1:112521525-112521547 GGATCCTAGCCTTTGAAGCTGGG + Exonic
913154083 1:116077322-116077344 GCATTCTTGTCCTGAAAACTAGG - Intergenic
913183544 1:116345699-116345721 GGTTCCTTGGCTGTAAAATTGGG - Intergenic
916683255 1:167122974-167122996 GGGTCCCTGTTTTTAAAATTTGG - Intronic
918412349 1:184272920-184272942 TGATCCCAGTCTTTAAAATTGGG + Intergenic
920937905 1:210453145-210453167 TGATCCTTGTTTTGAAAGCTGGG + Intronic
921697880 1:218232916-218232938 GTTTCCTTGTCTTTAAAATGGGG - Intergenic
923476502 1:234337247-234337269 AGATTCTTGTCTTCAAATCTGGG - Intergenic
923727001 1:236515158-236515180 GGATCTTTGTGTTTAAGACAGGG - Intergenic
924273497 1:242359700-242359722 GGTTCCTTGTCTGTAAAATGGGG + Intronic
1064436030 10:15311995-15312017 GCTTCCTTGTCTTTAAAAATGGG - Intronic
1066644568 10:37593003-37593025 GGATACTTCTCTGCAAAACTTGG + Intergenic
1066711220 10:38236954-38236976 GGTTCCTTGTCTGTAAAATGGGG - Intergenic
1068679032 10:59799019-59799041 GGATCCTTGTCTTCAAATAGGGG + Intronic
1069714913 10:70514491-70514513 GCCTCTTTCTCTTTAAAACTAGG - Intronic
1070685844 10:78480244-78480266 GAATCATTGGCTTTAGAACTTGG + Intergenic
1073309496 10:102530068-102530090 GGCTCCTCATCTGTAAAACTGGG - Intronic
1078100434 11:8327428-8327450 GGGTCCTTGTCTTTACATCTTGG - Intergenic
1078497221 11:11830322-11830344 GTTTCCTTGTCTGTAAAATTAGG + Intergenic
1078748442 11:14137541-14137563 GTTTCCTTATCTGTAAAACTGGG - Intronic
1079396249 11:20066505-20066527 GGCTCCGTGTATTTAAAAATTGG + Intronic
1081235986 11:40647726-40647748 AGCTCCTTTTCTTTGAAACTGGG - Intronic
1083993403 11:66260103-66260125 GTTTCCTTGTCTTTAAAATAGGG + Intronic
1084197931 11:67535951-67535973 AAAGCCTTGTCTTTAGAACTGGG + Intergenic
1085230787 11:74968016-74968038 GTATCCTTACCTTTAAAATTGGG - Intronic
1085606882 11:77908788-77908810 TGTTCATTGTCTTAAAAACTCGG - Intronic
1086383057 11:86278949-86278971 GGTTCCTTGTGTATAAAACAGGG + Intergenic
1087011677 11:93520168-93520190 GGATTCTTTTCTCTAAAACAAGG - Intronic
1087491471 11:98832713-98832735 TCAACCTTGTCTTTAAAAATGGG - Intergenic
1087538250 11:99480417-99480439 GTTTCCTTATCTGTAAAACTGGG + Intronic
1087923433 11:103893069-103893091 GGATCCTTGTCTTGTAAGCAAGG + Intergenic
1090512580 11:127391596-127391618 GGTTCCTTTTCTTTAAAATATGG + Intergenic
1090888319 11:130899049-130899071 GTTTCCTTGTCTTTAAAATGAGG + Intronic
1091444643 12:536871-536893 GGATGCTTATCTTTAAGACTGGG - Intronic
1093140154 12:15500497-15500519 GGATCCTTGTGCTCAAAAATTGG + Intronic
1094249179 12:28339871-28339893 GTGTCCTTGTCTGTAAAACAAGG + Intronic
1100954270 12:99889249-99889271 GTTTCCTTGTTTTTAAAACAAGG - Intronic
1101623374 12:106413438-106413460 GGTTCCCTGTCTGTAAAAATGGG + Intronic
1102817152 12:115875741-115875763 AGACCCTGTTCTTTAAAACTGGG - Intergenic
1107645940 13:42494577-42494599 CGATCCTTTTCTTTAGGACTGGG - Intergenic
1109136025 13:58652293-58652315 GGATCAGTGGCTTTCAAACTTGG - Intergenic
1109758608 13:66796316-66796338 AGACCCTTGTCTGTAAAACATGG + Intronic
1110108433 13:71710319-71710341 GGCACCTTTTCTTTAAAATTTGG - Intronic
1110658155 13:78025417-78025439 ATATACTTGTATTTAAAACTGGG + Intergenic
1112649367 13:101376333-101376355 GAATACTTGTCTTTAAAAATTGG + Intronic
1115352887 14:32414770-32414792 TGATCATTCTCTTTTAAACTTGG - Intronic
1116449335 14:45047686-45047708 GTTTCCTTGTCTATAAAATTAGG + Intronic
1117194812 14:53329288-53329310 GCCTCCTAGTCTTTAAAAGTGGG + Intergenic
1118026499 14:61774009-61774031 GTTTCCTTATTTTTAAAACTGGG - Intronic
1118047964 14:61992927-61992949 GGCTTTTTTTCTTTAAAACTAGG + Intergenic
1118969287 14:70619445-70619467 GGTTCCTTGTCTTAAAAATGGGG - Intergenic
1126547516 15:49889272-49889294 GGATCCTCCTCTGTAAAACGAGG + Intronic
1127548086 15:60008443-60008465 GGATCCTTCTTTTTAAAAAATGG - Intronic
1135064182 16:19295504-19295526 GGACTCTTGATTTTAAAACTGGG + Intronic
1137261907 16:46837765-46837787 CAATCCTTGTCTTTAAAAGTTGG + Intergenic
1137774880 16:51046229-51046251 GGATCCTTCTCTGGAAAACCCGG - Intergenic
1138115004 16:54353458-54353480 GCCTCCTTGTCTTTAAAATAGGG - Intergenic
1140118237 16:72061266-72061288 GTTTCCTTGTCTGTAAAACAAGG - Intronic
1140120270 16:72077457-72077479 GTTTCCTTGTCTGTAAAACAAGG - Intronic
1140682151 16:77395597-77395619 GGAGCTATGTTTTTAAAACTGGG - Intronic
1140872625 16:79121088-79121110 GGATACTTGTCTTTAAATGTAGG + Intronic
1142334980 16:89482606-89482628 GGATCCTTGTGGTTACAAATTGG - Intronic
1143061429 17:4204978-4205000 GGATACTTGTATTAAAACCTTGG + Intronic
1144594235 17:16553545-16553567 TCATCATGGTCTTTAAAACTTGG + Intronic
1144736590 17:17559092-17559114 GTTTCCTTGTCTGTAAAAATGGG - Intronic
1146668609 17:34721480-34721502 GTTTCCTTGTCTGTAGAACTAGG - Intergenic
1147484960 17:40803995-40804017 GTTTCCTTATCTTTAAAACAGGG - Intergenic
1147744301 17:42685767-42685789 GGCTTCCTGTCTGTAAAACTGGG - Intronic
1148142071 17:45336137-45336159 GTTTCCTTGTCTGTAAAACAGGG + Intergenic
1148157060 17:45430600-45430622 GAAGCCTTGGCTTTAAAACGAGG + Intronic
1149449446 17:56738383-56738405 GGTTCCTTGTTTGTAAAACGGGG - Intergenic
1151713920 17:75821957-75821979 GGGTCCTTGTCTGTAAAACAAGG + Intronic
1152372708 17:79900329-79900351 GGATCATTTTCTTTAAAAAGTGG - Intergenic
1153954211 18:10082478-10082500 GGAGCCTTGTCTTTCAGAGTAGG + Intergenic
1154952310 18:21222206-21222228 GGATAATTATCTTTAAGACTTGG + Intergenic
1156054842 18:32989027-32989049 GAAACTGTGTCTTTAAAACTTGG - Intronic
1158388022 18:57016640-57016662 GGTTCCTTCTCTGTACAACTGGG + Intronic
1158980614 18:62757059-62757081 GTATCCTTAACGTTAAAACTTGG + Intronic
1160019084 18:75166594-75166616 GGATCCTTGTATGGAAGACTGGG - Intergenic
1160084770 18:75766238-75766260 GGATCCCTGCCTATGAAACTGGG + Intergenic
1161815981 19:6500438-6500460 GCCTCCTCGTCTTTAAAACAGGG - Intronic
1166209893 19:41299638-41299660 TGATCCTTGTCTTTCAGACGAGG + Intronic
1166228405 19:41411398-41411420 GGATCCTTGTCCCTGATACTAGG - Intronic
929929108 2:46238464-46238486 GTTTCCTTGCCTCTAAAACTAGG - Intergenic
930004058 2:46882091-46882113 GCATCCTTGTCTGTAAAAGGGGG - Intergenic
931726669 2:65118023-65118045 GTTTCCTTGTTTGTAAAACTAGG + Intronic
931766970 2:65465580-65465602 TGATGCTTGTCTTTGAAGCTTGG + Intergenic
933099882 2:78241128-78241150 GTGTGCTTGTCTTTACAACTAGG + Intergenic
933328739 2:80870835-80870857 GGCTCCCAGTCTTTAAATCTTGG + Intergenic
933454635 2:82505153-82505175 GTATACTTCACTTTAAAACTTGG + Intergenic
936646719 2:114380401-114380423 GTTTCCTTGTCTTTAAAATGGGG + Intergenic
939362200 2:141186877-141186899 GGATCTTTGTTTTTAAGAATGGG + Intronic
940324735 2:152413182-152413204 GTATCCTTGTTTTAAAATCTGGG - Intronic
940656820 2:156497201-156497223 GGTTCCTTGTCTTTCAAATGAGG + Intronic
940877404 2:158911625-158911647 GCATCCTTATATTTAAACCTTGG - Intergenic
941102994 2:161318578-161318600 GATTGCTTGTCTTTAAAACTGGG + Intronic
941209994 2:162625546-162625568 GCATCCTTTTCTTTAAAATGGGG - Intronic
941737268 2:168992648-168992670 GTTTCCTTGTCTTTAAAATAGGG - Intronic
942064104 2:172253933-172253955 GGTTCCTTGTCTTTAAAGTGAGG + Intergenic
943275180 2:185857686-185857708 GCATTCTTGTCTCTAGAACTGGG - Intergenic
943522980 2:188976834-188976856 GCATCTTTGTACTTAAAACTTGG - Intronic
943603308 2:189946479-189946501 ATATACTTGTTTTTAAAACTAGG - Intronic
944403583 2:199356517-199356539 AGATCGTTGTCTTTAAAAACTGG - Intronic
944503769 2:200388727-200388749 GGATTCTTATGTTTAAACCTGGG + Intronic
945907216 2:215607764-215607786 CGATCCTTCTCTTTAAAAATTGG - Intergenic
946428205 2:219611104-219611126 GGTTCCTCGTCTATAAAACAGGG - Intronic
947520474 2:230842013-230842035 GTTTCCTTGTCTGTAAAACCAGG + Intergenic
1169275430 20:4230600-4230622 GGAGACTTTTCCTTAAAACTTGG + Intronic
1169406606 20:5326550-5326572 GATTCCTGGGCTTTAAAACTAGG - Intergenic
1169452288 20:5722294-5722316 GTTTCCTTGTCTTTAAAATCAGG + Intergenic
1170679568 20:18513931-18513953 ACTTCCTTGTCTTTAAAATTAGG + Intronic
1171793870 20:29551402-29551424 GTTTCCTTGTCTGTAAAACGGGG + Intergenic
1172560437 20:35883339-35883361 GGCTCTTTGTCTGTAAAACAGGG - Intronic
1172950701 20:38721879-38721901 GTTTTCTTGTCTGTAAAACTAGG + Intergenic
1173635440 20:44552646-44552668 GGTTCCTTATCTGTAAAACATGG + Intronic
1173738194 20:45376569-45376591 GCTTCCTTATCTGTAAAACTAGG + Intronic
1174261303 20:49297452-49297474 GTTTCCTTGTCTGTAAAACTGGG - Intergenic
1174693317 20:52531535-52531557 GGATCAATTTCATTAAAACTTGG + Intergenic
1177224274 21:18233406-18233428 ATTTCCTTATCTTTAAAACTGGG + Intronic
1178666429 21:34551100-34551122 GGGCTCTTGTTTTTAAAACTGGG + Intronic
1180107826 21:45631425-45631447 TGTTCCTTGTCTTTGAAACTGGG - Intergenic
1183670761 22:39271030-39271052 GTGTCCTTGTCTATAAAACAGGG + Intergenic
950438839 3:12995490-12995512 GTGTCCTTGTCTGTAAAATTGGG - Intronic
950565969 3:13769775-13769797 GGGTGCTAGTTTTTAAAACTGGG + Intergenic
951540962 3:23781397-23781419 GGAACCTTCTTTTTATAACTAGG - Intergenic
953373314 3:42407955-42407977 GCTTCCTTATCTTTAAAAGTGGG + Intronic
953960189 3:47260635-47260657 GTGTCCTCGTCTATAAAACTGGG - Intronic
955798988 3:62667109-62667131 GTTTCCTTATCTGTAAAACTGGG + Intronic
956334496 3:68147795-68147817 TGATCCTTGTGTATAAAACAGGG + Intronic
956573285 3:70721236-70721258 TGATCCTCGTCTATAAAACAGGG - Intergenic
957996783 3:87700068-87700090 GAATCATTGTCTTTCAAAATTGG - Intergenic
958018619 3:87970682-87970704 GAATCCGTGTCTTGAAAACAAGG - Intergenic
958904698 3:99928830-99928852 GGTTCCTTTTGTTTAAAATTTGG + Intronic
959792362 3:110378106-110378128 GGATAATTTTCTTTAAAAATAGG + Intergenic
960291362 3:115889181-115889203 GGTTCCTTGTGTTTAAAAACTGG + Intronic
961302533 3:125931345-125931367 GGATGCTTTTCTTTCATACTAGG + Intronic
963394134 3:144710311-144710333 GTATTCGTGTGTTTAAAACTGGG - Intergenic
964875101 3:161358241-161358263 GTTTCCTTATCTTTAAAACAGGG - Intronic
968530794 4:1090366-1090388 GTTCCCTTGTCTTTAAAGCTGGG + Intronic
969273958 4:6122506-6122528 AGATTCTTGTCTTTAAAAGATGG + Intronic
971999547 4:34012875-34012897 GGGTACTTGTATTTTAAACTAGG + Intergenic
972677047 4:41270069-41270091 GTATCCTTATCTATAAAACAAGG - Intergenic
973894697 4:55399840-55399862 GGATCCTTGTCTTTAAAACTAGG + Intronic
976329716 4:83815345-83815367 GGAACCTTGTCTTTTAAAATAGG + Intergenic
976632859 4:87256896-87256918 GTTTTCTTTTCTTTAAAACTAGG + Intergenic
977008888 4:91610737-91610759 GCAAACTTGTTTTTAAAACTAGG + Intergenic
978383357 4:108154327-108154349 GGATCCTTGTCTTTAACACCGGG + Intronic
979831201 4:125306406-125306428 GTATCCTTGAATTTTAAACTGGG - Intergenic
980557130 4:134423323-134423345 GCTTCCTTCTCTTTAAAACAAGG + Intergenic
981271689 4:142853173-142853195 GTTTCCTTATCTGTAAAACTAGG + Intergenic
981289225 4:143054709-143054731 GGTTCCTTGCCTATAAAAATGGG - Intergenic
981511107 4:145559767-145559789 GCATTCTTTTCTTTAAAACTAGG - Intergenic
981529708 4:145740518-145740540 GAATCCCTCTCTTTAAAAGTGGG - Intronic
981935916 4:150239760-150239782 GGAACCAAGTCTTTGAAACTGGG + Exonic
983435672 4:167711833-167711855 GATTCCTTCTCCTTAAAACTTGG + Intergenic
987284660 5:16443713-16443735 GGTTCCTTATCTTTAAAATGAGG - Intergenic
992200197 5:74375784-74375806 GGATTGTTGTCTTTAAAACGGGG + Intergenic
992957804 5:81928196-81928218 GGATTTTTCTCTTTCAAACTGGG + Intergenic
994083626 5:95734549-95734571 GGATCCTTGCCTTATATACTTGG + Intronic
994282106 5:97917438-97917460 AGATCCTTCTCTTTAAAATATGG - Intergenic
994310409 5:98262546-98262568 ACATCCTTGGCTCTAAAACTGGG + Intergenic
994695530 5:103069125-103069147 GGACCCTTTTCTTGAAAACTAGG + Intergenic
995489982 5:112680534-112680556 GGATTCTTGTCTTTTAAGATGGG - Intergenic
996613914 5:125416548-125416570 GGATCCTAGTCTTCCATACTAGG - Intergenic
998964816 5:147527744-147527766 GCATCTTTGTCTTTGAAACCGGG + Intergenic
1000747278 5:165049273-165049295 AGATCCTTGTTTTGAACACTAGG - Intergenic
1001224428 5:169931631-169931653 GCTTCCTTGTCTGTGAAACTGGG + Intronic
1001464676 5:171952977-171952999 AGAACCTTGTCTCTAAAACAGGG - Intronic
1006677441 6:35774497-35774519 GGTTCCTAGTCTGTAAAACAGGG + Intergenic
1010485803 6:76412341-76412363 GATTCCTCATCTTTAAAACTTGG - Intergenic
1013734098 6:113205705-113205727 GTTCCCTTGTCTGTAAAACTGGG + Intergenic
1013936072 6:115595185-115595207 GGGTCCCTGCCTTTAATACTAGG + Intergenic
1014222599 6:118813054-118813076 GAATTTTTGTCTTTGAAACTTGG - Intergenic
1015699882 6:136024199-136024221 GGATCCATTTCTATAAAACATGG - Intronic
1016024905 6:139277179-139277201 GGATTCTTGTGATGAAAACTGGG - Intronic
1016101916 6:140113518-140113540 GAATCCTTGTGTTGAAAATTTGG - Intergenic
1017279534 6:152608625-152608647 AGTTACTTGTCTTTAAAAATTGG + Intronic
1019287976 7:233129-233151 GTTTCCTTGTCTTTAAAATGGGG + Intronic
1019389122 7:775488-775510 AAAACCTTGTCTTTAAAAGTAGG + Intronic
1021930385 7:25575418-25575440 GGATCATTTTCTGTAAAACAGGG - Intergenic
1023430349 7:40084824-40084846 TTTTCCTTGTCTTTAAAAATGGG - Intronic
1024887621 7:54162237-54162259 GTTTCCTTGGATTTAAAACTAGG + Intergenic
1026267337 7:68806834-68806856 GTCTCCTTGTCTGTAAAAATAGG - Intergenic
1027797557 7:82713560-82713582 AAAACCTTGTCTTTAAACCTGGG - Intergenic
1028763031 7:94516797-94516819 GGAACTTTCTGTTTAAAACTAGG + Intronic
1030646705 7:112069613-112069635 AGAGCTTTCTCTTTAAAACTTGG + Intronic
1032454671 7:132064303-132064325 TCTTCCGTGTCTTTAAAACTTGG + Intergenic
1032745089 7:134778384-134778406 AGATACTGGTCTTTAAAAATGGG - Intronic
1033685142 7:143632813-143632835 GGTTCCTTAACTTTAAATCTCGG + Intronic
1033688315 7:143712032-143712054 GGTTCCTTAACTTTAAATCTCGG + Intronic
1033699472 7:143824808-143824830 GGTTCCTTAACTTTAAATCTCGG - Intergenic
1034711298 7:153193561-153193583 GGATGCTTGTCTGTAATACTTGG - Intergenic
1034849690 7:154482012-154482034 GTTTCCTTATCTTTAAAACTAGG - Intronic
1034855442 7:154541808-154541830 GGATCCTTATCTGTAAAACCAGG - Intronic
1036438906 8:8762473-8762495 GAATCCATGTCTTTGAAACATGG - Intergenic
1037029123 8:14080260-14080282 GTTTTCTTGTCTATAAAACTTGG + Intergenic
1037559274 8:20057925-20057947 GTTTCCTTAGCTTTAAAACTGGG + Intergenic
1037930418 8:22876921-22876943 GGACCCTTATCTTTAAAATGAGG + Intronic
1038114749 8:24540837-24540859 GTTTCCTTGTCTGTAAAACTGGG - Intergenic
1038261907 8:26003030-26003052 GGATCCTTGTCTGCAAAATGAGG - Intronic
1041236157 8:55804738-55804760 GAATTTTTTTCTTTAAAACTGGG + Intronic
1042280892 8:67054826-67054848 GTATCCTTGGATTTAAAACAGGG - Intronic
1042861057 8:73314815-73314837 GGATCTTTGTCTTAAAAATGTGG + Intronic
1043138701 8:76560102-76560124 GGATCCATTTCTTCAATACTTGG + Intergenic
1043484812 8:80688460-80688482 GGGTCCTCATCTATAAAACTGGG - Intronic
1044462581 8:92463050-92463072 TGTTCCTTGTCTTTAAGACCTGG - Intergenic
1044559504 8:93598517-93598539 TGATCCTTGCCTTTGAATCTAGG - Intergenic
1044760999 8:95517537-95517559 GGATCCATGTCTTCAGACCTTGG + Intergenic
1045306784 8:100964339-100964361 GCATCCTTGTCTTAATAATTTGG + Intergenic
1047889830 8:129295366-129295388 GTTTCCTTGTCTTTAAAGCAGGG + Intergenic
1049022026 8:139963788-139963810 GCATCCTTGTGTTTGAGACTTGG - Intronic
1050494738 9:6229181-6229203 GTTTCCTTGTCTTCAAAACAAGG - Intronic
1052220400 9:26015052-26015074 GTTTCCTTATCTTTAAAACAAGG + Intergenic
1052364477 9:27596510-27596532 GGATACTTGTCATTAAATGTAGG + Intergenic
1053364486 9:37512815-37512837 GGATCCAGGTGTTTAAATCTGGG + Intronic
1054152753 9:61618551-61618573 GTTTCCTTGTCTGTAAAACGGGG + Intergenic
1056918724 9:90766768-90766790 AAAGCCTTGTCTTTAAACCTGGG - Intergenic
1057533619 9:95876330-95876352 GGCTCCTCATCTGTAAAACTGGG + Intronic
1057767860 9:97939007-97939029 GGCTCCTTGTCTTCACAAATGGG - Intronic
1061226952 9:129285978-129286000 GTATCCTTGTCTATAAAATGGGG - Intergenic
1061909186 9:133713815-133713837 GCGTCCTAGTCTATAAAACTGGG + Intronic
1186465334 X:9780265-9780287 GCAGCTTTGTCTTTAAGACTTGG + Intronic
1186645944 X:11507386-11507408 GTCTCCGTGTCTTTAAAACAAGG + Intronic
1187588758 X:20692844-20692866 GAAGCCTTGCCTTTAAAAGTGGG - Intergenic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1188472432 X:30555451-30555473 GGACCCTTGTAATTACAACTGGG - Intergenic
1188668585 X:32855368-32855390 TGATCCTTGTTTACAAAACTAGG + Intronic
1190914616 X:54801834-54801856 ATATCCTTGTCTTAAAAAATGGG + Intergenic
1192430086 X:71105923-71105945 TGAACCTTATCTTTAAAACAAGG - Intronic
1197071319 X:122301230-122301252 GGATACATGTCTTTACAAATTGG - Intergenic
1199748662 X:150793738-150793760 AGATCCTTGTCTGAAAAACCTGG + Exonic
1199766480 X:150945279-150945301 GGTTCCTTGGCCATAAAACTGGG - Intergenic
1201637687 Y:16143481-16143503 GGAAGCTTGTATTTAAAACCTGG - Intergenic