ID: 973895507

View in Genome Browser
Species Human (GRCh38)
Location 4:55408647-55408669
Sequence CTGTTCCTCTGTAAAATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973895507_973895512 12 Left 973895507 4:55408647-55408669 CCCTACATTTTACAGAGGAACAG 0: 1
1: 0
2: 4
3: 37
4: 297
Right 973895512 4:55408682-55408704 GTGGCTGAAGTTTCATGGCTGGG 0: 1
1: 0
2: 2
3: 14
4: 180
973895507_973895509 -7 Left 973895507 4:55408647-55408669 CCCTACATTTTACAGAGGAACAG 0: 1
1: 0
2: 4
3: 37
4: 297
Right 973895509 4:55408663-55408685 GGAACAGAGATTAAATAATGTGG 0: 1
1: 0
2: 2
3: 33
4: 310
973895507_973895510 7 Left 973895507 4:55408647-55408669 CCCTACATTTTACAGAGGAACAG 0: 1
1: 0
2: 4
3: 37
4: 297
Right 973895510 4:55408677-55408699 ATAATGTGGCTGAAGTTTCATGG 0: 1
1: 0
2: 1
3: 16
4: 227
973895507_973895511 11 Left 973895507 4:55408647-55408669 CCCTACATTTTACAGAGGAACAG 0: 1
1: 0
2: 4
3: 37
4: 297
Right 973895511 4:55408681-55408703 TGTGGCTGAAGTTTCATGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973895507 Original CRISPR CTGTTCCTCTGTAAAATGTA GGG (reversed) Intronic
902933629 1:19748486-19748508 CTATTTCTCAATAAAATGTATGG - Intronic
903143602 1:21355573-21355595 CTCCTCCTTTGTAAAATGAAGGG + Intergenic
903672768 1:25046290-25046312 TTGCTCCTCTGTAAAATGGAGGG + Intergenic
905741850 1:40378028-40378050 TTGTTACTCTGTATAATTTAGGG + Intronic
906935367 1:50209754-50209776 CTGACCCTATGAAAAATGTAGGG - Intergenic
907726413 1:57024722-57024744 TTGCTCATCTGTAAAATGAAGGG + Intronic
908636398 1:66170906-66170928 ATGCTCCTATTTAAAATGTATGG - Intronic
909742401 1:79046217-79046239 CTGTTGGTCTGTGAAATATATGG - Intergenic
910123508 1:83815909-83815931 TTTGTCCTCTGTAAAATGAACGG - Intergenic
910734610 1:90439152-90439174 CTGTTCCACTTTAAAAAGCAGGG + Intergenic
911519383 1:98910235-98910257 CTGGCCCTCTGAAAAAAGTAAGG - Intronic
912488521 1:110048121-110048143 TTCCTCCTCTGTAAAATGAATGG + Intronic
913272084 1:117104250-117104272 CCTTTCATCTGTAAAATGTGTGG + Exonic
913680082 1:121181577-121181599 CTGTTCATCTGTAGAATCAATGG + Intronic
914031916 1:143969230-143969252 CTGTTCATCTGTAGAATCAATGG + Intronic
914157528 1:145098737-145098759 CTGTTCATCTGTAGAATCAATGG - Intronic
914417605 1:147498341-147498363 CTCTTCATCTGCAAAATGGAAGG - Intergenic
915641628 1:157231894-157231916 CTGTTCCTCAGAAAATTCTAAGG - Intergenic
917610780 1:176686818-176686840 CTCTTCATCTGTAAAATGAGGGG - Intronic
918645313 1:186897396-186897418 TTCTTCATCTGTAAAATGAAGGG + Intronic
918862171 1:189843873-189843895 TTGTTCCTCTTTTAAATGTTTGG + Intergenic
919324270 1:196086363-196086385 TTGTTTTTCTGTAAAAGGTATGG - Intergenic
919631476 1:199964178-199964200 TTCTTCCTCTGTAAAATGGGTGG + Intergenic
920168766 1:204056107-204056129 CTGTTCACCTATAAAATGAAAGG - Intergenic
920467392 1:206200113-206200135 CTGTTCATCTGTAGAATCAATGG + Intronic
920562677 1:206950089-206950111 CTGTTTCTCTGTTATATGGATGG + Intergenic
921059255 1:211568960-211568982 CTGTTTGTCTGTAAAATAAAGGG + Intergenic
924061113 1:240175401-240175423 CTGTTGCTATGGAAAATATATGG - Intronic
924068122 1:240247139-240247161 TTGTTCCTATGTAAAATCTTAGG + Intronic
1064237915 10:13593722-13593744 CTGTTTCACTGTGAAATGAAAGG + Intronic
1066976921 10:42377639-42377661 ATGTTCTTCTATACAATGTAAGG + Intergenic
1068657230 10:59588241-59588263 CTGTCCCACTGTAAAATGAAAGG - Intergenic
1070794673 10:79209767-79209789 TTCCTCCTCTGTAAAATGTGGGG - Intronic
1072851781 10:98902569-98902591 GTTTTCCTCTGTAAAATGGGAGG + Intronic
1073392188 10:103188439-103188461 ATATTCTTCTGTAAATTGTATGG - Intronic
1073606872 10:104905203-104905225 CTCTTCCTTTGTAAAAATTATGG - Intronic
1073690953 10:105808878-105808900 CGCCTCCTCTGTAAGATGTAAGG + Intergenic
1074188865 10:111118486-111118508 CTGTTCCTCTCTAGAGTGAATGG + Intergenic
1074881850 10:117665732-117665754 TTCTTCCTCTGTAAAATACAGGG - Intergenic
1074885351 10:117688957-117688979 TTCCTTCTCTGTAAAATGTAGGG + Intergenic
1075724197 10:124603334-124603356 CTGCTCCTCTGTAACAAGGAGGG - Intronic
1075898707 10:126020546-126020568 CTCTTTCTCTGGAAAATGTGGGG + Intronic
1077777472 11:5287461-5287483 TTCTTCATCTGTAAAATGGAGGG - Intronic
1078630137 11:12995103-12995125 CTTTTCTTCTGTAAAAGGAAGGG + Intergenic
1079349072 11:19677462-19677484 CTCCTCCTCTGTAAAATGAGGGG - Intronic
1082826482 11:57583592-57583614 CTTCTCCTCTGTAAAATGAAGGG - Intergenic
1082980178 11:59113976-59113998 CTTTCACTCTTTAAAATGTAAGG - Intronic
1083383309 11:62286736-62286758 ATGTTCTTCTATACAATGTAAGG + Intergenic
1083800380 11:65043143-65043165 CTGTTCCTCTGAAGAAGGCATGG + Intronic
1085240442 11:75049652-75049674 ATGTTCTTCTATACAATGTAAGG + Intergenic
1085951838 11:81341819-81341841 CTGCTGGACTGTAAAATGTAAGG - Intergenic
1086575882 11:88338480-88338502 CTTTTCCTCTGTAACATAAAAGG - Intergenic
1087000530 11:93415431-93415453 CTGTAGCTCTTTAAAATATACGG - Intronic
1087051562 11:93890751-93890773 CTGTACTGCAGTAAAATGTAAGG - Intergenic
1087185253 11:95184672-95184694 CTGTTCCGCTGTACATAGTAAGG - Intronic
1087511983 11:99107381-99107403 CTTTTTCACTGAAAAATGTATGG + Intronic
1088198783 11:107306954-107306976 CTGTAAGTCTGTGAAATGTATGG + Intergenic
1088456536 11:110038543-110038565 TTGTTTCCCTGTAAAATGTGAGG - Intergenic
1089069650 11:115689550-115689572 CTGTTCCTTTGGAATAAGTAAGG - Intergenic
1090086636 11:123655555-123655577 CTGTTACTCTGTGAGATGTCAGG - Intergenic
1090700870 11:129294409-129294431 CTGTGCCTTTGTAAAATTCAGGG - Intergenic
1091163847 11:133452762-133452784 GTGTTCTTCTGTCAAATGTGAGG + Intronic
1092684704 12:11029089-11029111 ATCTTCCTCAGTACAATGTAAGG - Intronic
1093870026 12:24279849-24279871 CTGACCCTCTGTAAACTGCAGGG + Intergenic
1095716146 12:45348720-45348742 TTCTTCCTCAGTAAAATGAAGGG + Intronic
1096025449 12:48357062-48357084 CTCTTCATTTGTAAAATGAAGGG - Intergenic
1096948687 12:55440626-55440648 CTGTTCCTCTAGTAATTGTAAGG - Intergenic
1098213413 12:68190051-68190073 CTGTTCATCTGTAACATCTTGGG - Intergenic
1098734423 12:74081321-74081343 CTGTTAATCTCTAAACTGTATGG + Intergenic
1099659776 12:85542363-85542385 ACGTTCATCTGTAAACTGTATGG + Intergenic
1099989122 12:89705468-89705490 GTATTCATGTGTAAAATGTAAGG + Intronic
1104051964 12:125201124-125201146 GTGTTTCTCTCTTAAATGTATGG + Intronic
1106079922 13:26491779-26491801 ATGATCCTCTGTAAAACGAATGG - Intergenic
1106635110 13:31520217-31520239 CTGTTCAACTATAAAATGTGAGG + Intergenic
1107640855 13:42441696-42441718 CTGTTCCTCTGTAAAAGGGCAGG - Intergenic
1107781836 13:43911913-43911935 CTCTTCATTTGCAAAATGTAGGG - Intergenic
1108901603 13:55416107-55416129 CTGTTACTCTGAAGAATTTAAGG + Intergenic
1109616930 13:64847648-64847670 CTGTTCCACAGTAAAATGCAAGG + Intergenic
1110055877 13:70970447-70970469 CTTTTCCTCTTTTATATGTAAGG - Intergenic
1110167316 13:72459302-72459324 CTCTTCCTCTGTGTAAGGTATGG + Intergenic
1112672757 13:101660008-101660030 CTGTTCTTCTGTGCATTGTAGGG + Intronic
1114288125 14:21265093-21265115 CTGTTCTTTTTAAAAATGTATGG - Intronic
1114377430 14:22163232-22163254 TTGTTCATATGTAAAATGAAGGG + Intergenic
1114713015 14:24797355-24797377 CTGTTCCTCTGGAAGCTCTAGGG + Intergenic
1115042964 14:28954476-28954498 TTGTTCTTCAGTAATATGTAAGG + Intergenic
1115659494 14:35478222-35478244 CTCTTCCTCAGTAAACTGTAAGG + Intergenic
1115733161 14:36294056-36294078 CTTTCCCTGTGTAAAAAGTAGGG + Intergenic
1117732664 14:58739479-58739501 CTGTTCATCTGTAAAATTGAGGG + Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118299767 14:64604753-64604775 TTGTTCCTCTGAAAAAAGGAGGG - Intergenic
1119548363 14:75489964-75489986 TTCTTCATCTGTAAAATGTGGGG + Intergenic
1122485892 14:102079437-102079459 CTGTCCCTCTGAAAAAATTAAGG - Intergenic
1123146394 14:106134831-106134853 CTGTGCCGCAGTAAAATGTAAGG + Intergenic
1126238858 15:46417801-46417823 CTGCTCATCTGTAAAATGAGAGG + Intergenic
1128391622 15:67186439-67186461 CTGTGTCTCTGTATAATGAAGGG - Intronic
1128434547 15:67633043-67633065 CAGTGCCTCTGTAAAATGTGGGG - Intronic
1128623375 15:69172774-69172796 CAGTTACTCTGAAAATTGTAAGG + Intronic
1128691999 15:69731734-69731756 CTGTTGCTCTGTAAGAGGTTTGG - Intergenic
1129360075 15:75019092-75019114 CTGGTCCTTTGTACAAAGTAGGG - Exonic
1132415800 15:101618096-101618118 TTCTTCATCTGTAAAATGGAGGG - Intergenic
1133847232 16:9466666-9466688 CTGAGTCTCTGTAAAATGGAGGG + Intergenic
1134890054 16:17832982-17833004 ATGTTCCTCTTTAGCATGTATGG - Intergenic
1135463135 16:22662350-22662372 CTGTACCTCTGGAAAAGGCAAGG - Intergenic
1136692666 16:32046630-32046652 CTGTGCTGCAGTAAAATGTAAGG - Intergenic
1136793163 16:32989856-32989878 CTGTGCTGCAGTAAAATGTAAGG - Intergenic
1136876690 16:33864201-33864223 CTGTGCTGCAGTAAAATGTAAGG + Intergenic
1137438667 16:48479900-48479922 CTGTTCCAATGTAAAATCCAGGG + Intergenic
1138366113 16:56479089-56479111 ATGTTCACCTGTAAAATATATGG + Exonic
1140178236 16:72687181-72687203 TTGTTCCTCTGTATAATTTTTGG + Intergenic
1141627522 16:85269066-85269088 TTGTCCATCTGTAAAATGCAGGG - Intergenic
1141691605 16:85599940-85599962 CTTTTCCTCTCTAAAATGGGAGG + Intergenic
1203095419 16_KI270728v1_random:1251547-1251569 CTGTGCTGCAGTAAAATGTAAGG - Intergenic
1143871578 17:9960498-9960520 CTCTTCCTTGGTAGAATGTAAGG + Intronic
1144118665 17:12127946-12127968 ATCTTCCTCTGTAATATGTTTGG + Intronic
1144621557 17:16821710-16821732 TGCTTCCTCTGTAAAATGTAAGG + Intergenic
1144884861 17:18451003-18451025 TGCTTCCTCTGTAAAATGTAAGG - Intergenic
1145100590 17:20073377-20073399 TTGTACCTCTCCAAAATGTAAGG - Intronic
1145147363 17:20493374-20493396 TGCTTCCTCTGTAAAATGTAAGG + Intergenic
1146200849 17:30857150-30857172 TTTTTCCTCTGCAAGATGTAAGG - Intronic
1146690033 17:34867099-34867121 CTCTTCCTCTGTAAAATGGGAGG - Intergenic
1147192360 17:38745546-38745568 GTGCTCATCTGTAAAATGAAAGG - Intronic
1147695353 17:42348285-42348307 CTGTTCCATTAAAAAATGTATGG - Intronic
1148085677 17:44992491-44992513 CTGTCCCTCTGGATAATGAATGG - Intergenic
1148972847 17:51499526-51499548 TTTTTCTTCTATAAAATGTAAGG + Intergenic
1149037500 17:52151794-52151816 CTCCTCATCTGTAAAATGTGAGG - Intronic
1149913405 17:60586745-60586767 CTGTTCTGCTGTGAAAGGTATGG + Intergenic
1150239516 17:63621145-63621167 CTGTTCCAGTGTAATATGTCAGG - Intergenic
1150307450 17:64098340-64098362 TTCTTCATCTGTAAAATGGAGGG - Intronic
1151219794 17:72603997-72604019 TTCTACCTCTGTAAAATGAAGGG - Intergenic
1151452836 17:74209576-74209598 CTGTTCCCCTGTAAAAAATGGGG - Intronic
1152579719 17:81160522-81160544 TTGTTCCTCTGTGAAAGGCAGGG + Intronic
1153020561 18:625011-625033 CTGGTCCTCTGTGAAAAATAAGG + Exonic
1153236035 18:2989127-2989149 TTCTTCATCTGTAAAATATAGGG - Intronic
1153727634 18:7973550-7973572 CTTTTCCTTTTTAAATTGTAGGG + Intronic
1156442497 18:37205535-37205557 CTGTTCCTCTCTAAAATATGGGG - Intronic
1157497251 18:48165134-48165156 TTCCTCCTCTGTAAAATGAAGGG - Exonic
1157531837 18:48427868-48427890 CTCCTCATCTGGAAAATGTAAGG + Intergenic
1158865886 18:61637189-61637211 CTGCTCCTCTAGAAAATGCATGG - Intergenic
1159197872 18:65141886-65141908 CCCTTTCTCTGTATAATGTAGGG - Intergenic
1159907375 18:74107766-74107788 CTATTCCTCTGGAAAAGGGAGGG + Intronic
1161675634 19:5646959-5646981 CTGTTACTCTGTAAAAAGAAGGG + Intronic
1163891914 19:20024177-20024199 TTCTTCCTCTGTAGAATGTTTGG - Intronic
1163907719 19:20161627-20161649 GTGTTCTTCTATACAATGTAAGG - Intergenic
1165194744 19:34093162-34093184 CTGTTCCTCAGGAAAATATGAGG + Intergenic
926227382 2:10977990-10978012 CTCTTCCTTTGAAAAATGTCAGG - Intergenic
926253957 2:11173909-11173931 CTGTTTATCTATAAAATGCAAGG + Intronic
926586051 2:14686830-14686852 CTGTTAATCTCTAAAATATAGGG + Intergenic
926766391 2:16326003-16326025 CTTTTCATCTGTAAAATGAGAGG - Intergenic
926978888 2:18545301-18545323 CTGTTCCTCCTTAAAATATCTGG - Intergenic
927606320 2:24490607-24490629 CTTTTCATCTGTAAAACGAAGGG + Intergenic
928912050 2:36431804-36431826 GTGTTCATCTGTAAAATGAGGGG - Intronic
931473115 2:62559914-62559936 TTCTTCATCTGTAAAATGTCAGG + Intergenic
931941523 2:67256970-67256992 TTCTTCATCTGTAAAATGTTGGG + Intergenic
932247806 2:70211073-70211095 CTGTTTCTAGGTAAAATGCAGGG + Exonic
932769790 2:74494184-74494206 AGGTTCCTCTGTGAAAGGTAAGG - Exonic
932862140 2:75305233-75305255 CTGTCCCTCTGGAAAAAGTTAGG - Intergenic
935540503 2:104342138-104342160 ATTTTCCTCTTTAAAATGAAGGG - Intergenic
937750131 2:125466938-125466960 CTCTTACTCTGTTAACTGTAGGG + Intergenic
938220398 2:129561286-129561308 TTGCTCCTCTGTAAAAGGAAAGG - Intergenic
939052431 2:137323784-137323806 ATATTCATCTGTAAAATTTATGG - Intronic
939706783 2:145464617-145464639 CTGTTAACCTTTAAAATGTATGG + Intergenic
941192103 2:162397563-162397585 TTGCTCTTCTGTAAAATCTAGGG + Intronic
941378829 2:164765827-164765849 CTTTTCATCTGTAAAATGAAGGG + Intronic
941590408 2:167413589-167413611 CTGTTCATTTTTAAAGTGTATGG + Intergenic
942062626 2:172241643-172241665 TTCTTCATCTGTAAAATGAAAGG - Intergenic
943696268 2:190936850-190936872 CTATTCATCTGTAAAAAGTTTGG + Intronic
943813402 2:192219799-192219821 CTGTTCATCTTTAAAATATTAGG + Intergenic
944381308 2:199113874-199113896 CTTTTTCTCTGTAACATGTATGG - Intergenic
945031293 2:205665947-205665969 TTCTTCCTCTATAAAATGAAGGG - Intergenic
945681482 2:212919127-212919149 CTGTCCCACTGTAAAATCTTTGG + Intergenic
945993334 2:216414709-216414731 CTGCTCCTCTGTAAGAGGCAAGG - Exonic
946257043 2:218450332-218450354 CTGTTCCTCTGTATCCTTTACGG - Exonic
946273451 2:218612964-218612986 TTTTTCATCTGTAAAATATAGGG + Intronic
1170116944 20:12870726-12870748 TGCTTCCTCTGTAAAATGAAAGG - Intergenic
1172185600 20:33029225-33029247 CTGTTCCAATGTAAATAGTATGG - Intergenic
1173052557 20:39577811-39577833 GGGTTTCTCTGTAAGATGTAAGG + Intergenic
1173083905 20:39896735-39896757 TTTTTCCTCTGTAAATTGCAGGG + Intergenic
1174202572 20:48817391-48817413 CTGTTCCTCTGCAAAAAGTAGGG + Intronic
1175177761 20:57123402-57123424 TACTTCCTCTGTAAAATGAAGGG - Intergenic
1175405093 20:58720575-58720597 CTCCTCATCTGTAAAATGGATGG + Intergenic
1175612511 20:60363615-60363637 CTGTTTCTCTCCAAAATGAAAGG + Intergenic
1175653412 20:60748609-60748631 CTGTTCCTCACTGAAATGGATGG - Intergenic
1177009591 21:15715881-15715903 CTCTTCCTCACTATAATGTAAGG - Intergenic
1181677848 22:24468746-24468768 CTGTTATCCTGTAAAATGAAGGG + Intergenic
1181746380 22:24957568-24957590 TTCTTCCTCTGTAAAATGGGAGG + Intronic
1181999368 22:26907795-26907817 CTGTTTCTCTGTTATATTTAAGG - Intergenic
1183924944 22:41199052-41199074 CAGATTCTCTGTGAAATGTATGG - Intergenic
950432786 3:12960557-12960579 CTGGTCCTCTGGTAAATGCATGG - Intronic
950759178 3:15205907-15205929 CCTTTCCTCTGTTAAGTGTAAGG - Intergenic
951141589 3:19168522-19168544 TTCTTCCTCTGTAAATTGTATGG + Intronic
951546999 3:23836501-23836523 GTGTTCCTCTGAAAACTGCAAGG + Intronic
952246145 3:31594809-31594831 CTGTTTATCTGTATAATTTAGGG - Intronic
953308099 3:41849014-41849036 CTCTGCCTCAGTAAACTGTAAGG + Intronic
953375063 3:42421565-42421587 GTCTTCCTCTGTAAAATGGGAGG - Intergenic
953394384 3:42555737-42555759 TTCTTCCTCTGTAAAATGAGAGG + Intronic
954042171 3:47896951-47896973 TTGTTCCTCTATAAAATGAGGGG - Intronic
954297539 3:49682538-49682560 CTGTTCCACTGCAAACTGCAGGG - Exonic
954915673 3:54147063-54147085 CTGTTCCTCTGAAAAAGGTATGG - Intronic
955252282 3:57295880-57295902 CTATTCCTGTTTAAAATATATGG - Intronic
956891470 3:73618185-73618207 TTTTTCATCTGTAAAATGGAAGG + Intronic
957570102 3:81936039-81936061 CTCCTCCTCTGAAAAATGTAGGG + Intergenic
959026367 3:101244291-101244313 CTCTTCCTCTGGAAAGTGTGTGG + Exonic
959051666 3:101530383-101530405 CTGTGCTGCAGTAAAATGTAAGG + Intergenic
959967384 3:112372443-112372465 TTCTTCATCTGTAAAATATAGGG - Intergenic
960146684 3:114211376-114211398 CTGAGGCTCTGTAAAATGGAGGG - Intergenic
962354918 3:134685675-134685697 GTGATTCTCTGGAAAATGTATGG + Intronic
962402529 3:135072910-135072932 CTGATCAACTGGAAAATGTAGGG - Intronic
964835935 3:160938860-160938882 CTGTTCCATAGTAAAATGCAGGG - Intronic
965271700 3:166624824-166624846 CATTTTCACTGTAAAATGTAAGG + Intergenic
965605945 3:170497602-170497624 TTGTTCATCTGTTAAATGAACGG + Intronic
967362130 3:188643167-188643189 TTTCTCCTCTGTAAAATGTCTGG - Intronic
968019984 3:195377108-195377130 TTCCTCCTCTGTAAAATGAAGGG - Intronic
968149581 3:196326499-196326521 CAGTTTATCTGTAAAATGGAGGG + Intronic
969315572 4:6379769-6379791 CTCCTCCTCTGTAAAATGAGGGG + Intronic
969846410 4:9923513-9923535 CTGTCCATCTGCAAAATGGACGG - Intronic
970039897 4:11784686-11784708 ATGTACATCTGCAAAATGTAAGG + Intergenic
970079670 4:12266390-12266412 CTGTTTTTCAGTAAAATGAATGG + Intergenic
970817074 4:20169124-20169146 CTATTTTTCTGAAAAATGTAGGG + Intergenic
971451184 4:26803573-26803595 CTGTTTCTCTCTGAAATGCAGGG - Intergenic
972273076 4:37531011-37531033 CTGTTTCTCTGTTAAAGGAAAGG + Intronic
972745876 4:41932445-41932467 CTCTTCCTCTGTCAGATGTGTGG - Intergenic
972894111 4:43597858-43597880 CTTTTCTTCTGAAAAATTTAGGG + Intergenic
972977821 4:44659159-44659181 CTGTGGCTCTGTAAAAGGGAAGG - Intronic
973079729 4:45975014-45975036 ATGTTCCTCTGAAATATTTAGGG + Intergenic
973880359 4:55265407-55265429 CTGTTAATCTGTGAAATGTATGG - Intergenic
973895507 4:55408647-55408669 CTGTTCCTCTGTAAAATGTAGGG - Intronic
973991325 4:56410817-56410839 ATCTTCCTCTGTAAATTGTGTGG - Intronic
974362930 4:60906278-60906300 TTGTTTTTCTGTAAAATGAAGGG + Intergenic
974511920 4:62854348-62854370 CTGTTTTTCCCTAAAATGTAGGG + Intergenic
974949448 4:68570335-68570357 GTGTTCTTCTGTACAATGTCTGG + Intronic
975874317 4:78817997-78818019 CTTTTCCTCCCTAAAATGGATGG + Intronic
976799920 4:88978151-88978173 CTTTTTCTCTCTAAAAAGTAAGG + Intronic
977289421 4:95147694-95147716 CTGTTCATCTGTCATATCTAGGG + Intronic
978380303 4:108120676-108120698 CTGATCATCTGAAAAATGTTGGG + Intronic
980578879 4:134722325-134722347 TTGTTCATTTGTAAAATGAAAGG + Intergenic
980607942 4:135117737-135117759 CTTTTTCTCTTTGAAATGTATGG - Intergenic
981047969 4:140282732-140282754 TTGATCATCTGTAAAATGAAAGG + Intronic
981743657 4:148030537-148030559 CTGTTGCTCTGAAAACTCTATGG + Intronic
981903850 4:149896761-149896783 CTGTCCCTCTGCAAAATTTTGGG - Intergenic
982424239 4:155238298-155238320 CTATTCCCCTGTATAATGCAGGG + Intergenic
983801513 4:171935759-171935781 GTGTACCTCTGTAAATTTTATGG + Intronic
984138342 4:175970337-175970359 CTGTGTCTCTGAAAACTGTAGGG - Intronic
984991066 4:185381758-185381780 CTGTTCCTCAGAAGAATGTGAGG + Intronic
987662703 5:20897573-20897595 TTTTTTCTCTTTAAAATGTATGG - Intergenic
988759988 5:34304625-34304647 TTTTTTCTCTTTAAAATGTATGG + Intergenic
988839927 5:35073529-35073551 TTCCTCCTCTGTAAAATGAATGG - Intronic
989269884 5:39520600-39520622 CTTCTCCTCTCTAAATTGTAAGG + Intergenic
989557372 5:42813366-42813388 GTGTTCTTCTGTACAATGTCTGG - Intronic
991990124 5:72329738-72329760 CTCCTCATCTGTAAAATGGAAGG - Intronic
992147967 5:73871256-73871278 CTGTTTCTCTTTAAAAGATAAGG + Intronic
992821546 5:80502567-80502589 ATGTTCATCTGTATAATGAAGGG - Intronic
994975995 5:106807032-106807054 CTTTTCATCTGTAAAAAGTCAGG + Intergenic
995764749 5:115602691-115602713 CTGTACCTCTGAAAGATCTACGG - Intronic
999133540 5:149302283-149302305 CTGTGGCTCTATAAAAGGTATGG + Intronic
999456700 5:151722752-151722774 TTCTTCCTCTGTAAAATGAAGGG - Intergenic
999466337 5:151809642-151809664 CTGATCCTTTGTAAAATGAAGGG - Exonic
1000174597 5:158738917-158738939 TTGTTCATGTGTAAAATGTCAGG - Intronic
1000735663 5:164896182-164896204 ATGTTTCTGTGTAAAATGTAAGG + Intergenic
1003064555 6:2892222-2892244 TTTCTCCTCTGGAAAATGTAGGG - Intronic
1003527582 6:6910878-6910900 CTGTTCCTGTTTTAAATGTGAGG + Intergenic
1005001127 6:21243032-21243054 CTGTTCCTCTGTAATGTGTCAGG + Intergenic
1006004589 6:30992223-30992245 CTGTTCCTCTCAAAAAAATAAGG + Intergenic
1006278426 6:33025675-33025697 CTGTTTCTGTGAAAAATGTAAGG + Intergenic
1006329731 6:33381826-33381848 GTGGTCCTGTGTAAAATGTAGGG - Intergenic
1008349233 6:50470072-50470094 TTGCTCCTCTGTAAAATGGGAGG - Intergenic
1009313882 6:62193230-62193252 TTGTTCCTCTGTTAAATTTAAGG + Intronic
1009388636 6:63118351-63118373 CTAGTCCTCTGTAAAATGTATGG + Intergenic
1009404355 6:63293456-63293478 CTGTTCATCTGGAAAATAGAGGG - Intronic
1011003241 6:82615056-82615078 GTTTTCATCTGTAAAATGAAGGG - Intergenic
1011496689 6:87943646-87943668 CTGTTCCCCCGTAGAATGAAAGG + Intergenic
1012646622 6:101691657-101691679 CTCTTCCTTTGTAAAAAGAATGG - Intronic
1013374207 6:109498329-109498351 GTATTGCTCTGTAAAATGGAGGG + Intronic
1013997649 6:116326654-116326676 CTCTTCATCTGTCAAATGTAAGG + Intronic
1014477869 6:121896610-121896632 TTTTTCATCTGTAAAATGAAAGG + Intergenic
1014789438 6:125655505-125655527 CGTTACCTCTGTAAAATGAAAGG + Intergenic
1015449215 6:133344983-133345005 CTGTTCCTTTCTAAAATGGAAGG - Intronic
1017352886 6:153464030-153464052 TTAGTCCTCTGTAAAATGTGAGG + Intergenic
1017406908 6:154129291-154129313 ATGTTCTTCTATACAATGTAAGG + Intronic
1017754724 6:157519714-157519736 CTCTTCCTCTGCAAAACGAAAGG + Intronic
1018723620 6:166592739-166592761 CCGTTGCCCTGTAGAATGTAAGG - Intronic
1019842444 7:3461699-3461721 CTGTTTCTCTGTAACATATAAGG - Intronic
1020193951 7:6022639-6022661 TTGTTCGTCTGCAAAATTTAGGG + Exonic
1020900877 7:14002256-14002278 CTGTTCATTTGTTAAATGTTGGG + Intergenic
1021177529 7:17467492-17467514 CTGGCCATCTGTAAAATGAAAGG + Intergenic
1021981025 7:26055759-26055781 CAGTTCCTTTGTAGAATGAAGGG + Intergenic
1023119385 7:36894085-36894107 TTTTTCCTCTTTAAAATATACGG + Intronic
1023295980 7:38715491-38715513 CAGTGCCTCTGTTAAATGTCTGG - Intergenic
1023579037 7:41661954-41661976 CTTTTCCTCTCTAAACTGAAAGG - Intergenic
1024708127 7:51984239-51984261 CTTTTACTCTGAAAGATGTAAGG + Intergenic
1026569084 7:71513840-71513862 CTGCTGCTCTGTAGAGTGTAAGG + Intronic
1027555665 7:79662008-79662030 CTGTTCCTTTGCAAAATATGTGG - Intergenic
1028329697 7:89574707-89574729 ATGTTCCTCTGAATTATGTAGGG + Intergenic
1028365548 7:90025904-90025926 CAGTTCCTCTTTAAAATGTTAGG - Intergenic
1030414540 7:109225771-109225793 CTGTTCCATTGTATTATGTAAGG + Intergenic
1030600626 7:111587955-111587977 CTCTTCCTGTGTAAAATTTCTGG + Intergenic
1035520056 8:268382-268404 CTATTCCTTTGTAAATTATAGGG + Intergenic
1037912120 8:22749697-22749719 TTGCTCCTCTGTAAAAGGCAGGG - Intronic
1038318958 8:26511458-26511480 CTTTTCCTTTCTAAAATGTGGGG + Intronic
1039147782 8:34468382-34468404 CTGTTCCTCTGTTTCATGCAGGG + Intergenic
1039627853 8:39073494-39073516 CTGTTCCTCACTAAACTGTAAGG + Intronic
1040598184 8:48860195-48860217 TTCTTCTTCTGTAAAATGTAGGG + Intergenic
1041185103 8:55290780-55290802 CTATTCCTTTGTAAAATATGTGG + Intronic
1041476843 8:58276879-58276901 CTCTTCCTCTATCAAATGGAGGG + Intergenic
1041492702 8:58452376-58452398 CTGATCCGCAGTGAAATGTAGGG + Intergenic
1041586083 8:59521431-59521453 GTCTTCTTTTGTAAAATGTATGG - Intergenic
1044142758 8:88675075-88675097 ATGTTCTTCTGTACAATGTCTGG - Intergenic
1044340847 8:91044764-91044786 TTGTTCCACTGTTAAATGTTGGG - Intergenic
1044420885 8:91994616-91994638 TTATTCATCTGTAAAATGAAAGG + Intronic
1047242335 8:123102230-123102252 TTCTTCCTGTGTAAAATGAAAGG - Intronic
1047243775 8:123119764-123119786 ATATCCATCTGTAAAATGTAAGG + Intronic
1047398279 8:124523893-124523915 CTGTTCTGCTGTAGAATATAAGG + Intronic
1048385266 8:133906529-133906551 CTGTTCCTCTCTGAAATCTGAGG - Intergenic
1048462411 8:134632554-134632576 CTGTTTCTCTGTTATCTGTATGG - Intronic
1048600756 8:135916520-135916542 TGGTTCATCTGTAAAATGAAGGG - Intergenic
1049182668 8:141231026-141231048 CTTCTCCCCTGTAAAATGGAGGG + Intronic
1051768876 9:20554667-20554689 CTTTCCCTCTGTAAAATACATGG + Intronic
1052026156 9:23575670-23575692 TTGTACATCTGTAAAATGGAGGG + Intergenic
1054856586 9:69906837-69906859 TTGCTCATCTGTAAAATGTGAGG - Intergenic
1055149987 9:72985293-72985315 CTTTTGCTCTGTAAAATGATAGG - Intronic
1055506820 9:76956507-76956529 GTGTTCTTCTATACAATGTAAGG - Intergenic
1056074295 9:83022511-83022533 CTCTTCATCTGTAATATATAGGG - Intronic
1057104633 9:92401229-92401251 GTGTTTCTCTGTAAAATGAAGGG + Intronic
1058022547 9:100104130-100104152 CTGCTCATCTGTAAAATGAGAGG - Intronic
1058777337 9:108297238-108297260 CTGTTCCTCTGTATAGTATAGGG + Intergenic
1059591418 9:115666860-115666882 CTCCTCATCTGTAAATTGTATGG + Intergenic
1060911135 9:127352041-127352063 CTGTTCCTATGTAAAATGAAGGG + Intronic
1185684558 X:1917668-1917690 CCGTACCGCAGTAAAATGTAAGG + Intergenic
1188156085 X:26745149-26745171 TTTTTCCTCTGTAAAATGAAGGG + Intergenic
1188897927 X:35693490-35693512 ATGTTCTTCTATACAATGTAAGG - Intergenic
1189422868 X:40872160-40872182 CTGTTCGTATTTAAAATGTGGGG - Intergenic
1189596106 X:42567129-42567151 CTGTTCCTCTTTATAATGTTGGG + Intergenic
1192223700 X:69214488-69214510 GTCTTCATCTGTAAAATGCAGGG + Intergenic
1192225470 X:69224311-69224333 TTCTCCCTTTGTAAAATGTAGGG - Intergenic
1193385429 X:80865452-80865474 ATCTTCATCTGTAAAATGTGAGG - Intergenic
1197014793 X:121610630-121610652 GTGTAACTCTGAAAAATGTATGG + Intergenic
1197501433 X:127246565-127246587 TTGTTCCTTTTTAAAATGTTAGG - Intergenic
1197605751 X:128583136-128583158 CTGTGCCATTGTAACATGTATGG - Intergenic
1198586457 X:138127775-138127797 CAGATCCTCTGTGGAATGTATGG + Intergenic
1199162848 X:144634581-144634603 ATGTTCTTCTGTACAATGTCTGG - Intergenic