ID: 973897566

View in Genome Browser
Species Human (GRCh38)
Location 4:55430090-55430112
Sequence CTGGGGTTCTTGAATAAAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973897566 Original CRISPR CTGGGGTTCTTGAATAAAAA TGG (reversed) Exonic
902137964 1:14327018-14327040 CTGGGGATATTGAATCAAACAGG - Intergenic
902328835 1:15720552-15720574 CTGGTGTTCATGGATAAAACTGG + Intronic
902842144 1:19081566-19081588 CTCGGGTTCTAGAAGAAAAGCGG + Exonic
903556276 1:24195918-24195940 AGGGGGTTCTTGGATAAGAATGG - Intergenic
904144438 1:28378578-28378600 CTTGGGTTGTTAAAAAAAAAGGG - Intronic
906912138 1:49965312-49965334 CTGGTCTTCTTCATTAAAAATGG + Intronic
907634319 1:56118224-56118246 CTGGGGTTCATGGAAGAAAATGG + Intergenic
908017944 1:59865297-59865319 CTTGGATCCTTCAATAAAAAAGG - Intronic
908149937 1:61289300-61289322 CTGGTGGCCATGAATAAAAATGG - Intronic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
910533572 1:88269866-88269888 CTGGTGTTCTTTTAAAAAAATGG + Intergenic
910722179 1:90298564-90298586 CTGGGGTTTGGGAATAGAAAGGG - Intergenic
911226011 1:95306430-95306452 CAGGTGTTCTTGAAAAAAGAAGG + Intergenic
911835317 1:102611541-102611563 CTGGTTTTCTGAAATAAAAAAGG + Intergenic
914251792 1:145927808-145927830 CTGGGATTTTTGAAAGAAAAGGG - Intergenic
914293940 1:146301279-146301301 GTGGGGTAGTTGAATAAAATTGG + Intergenic
914554984 1:148752062-148752084 GTGGGGTAGTTGAATAAAATTGG + Intergenic
915119368 1:153619075-153619097 CTGGGGTTCTTGAGAAAGTAGGG + Intronic
916624473 1:166540181-166540203 CTGGGGTTCCTTAAAGAAAATGG - Intergenic
916691814 1:167197241-167197263 CTGAGGTTTTTGAAAACAAAGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
920079053 1:203359036-203359058 CAGAGATCCTTGAATAAAAATGG + Intergenic
920686456 1:208112740-208112762 CTGGGATTATTTAATAAAGACGG - Intronic
922178755 1:223217198-223217220 CTGGGGATTTTTAAAAAAAAAGG + Intergenic
922552701 1:226508163-226508185 ATGGGATTCTTGCCTAAAAATGG - Intergenic
923346805 1:233061590-233061612 CAGATGGTCTTGAATAAAAATGG + Intronic
923529272 1:234800781-234800803 CTGGGGTTCTTCTGTAAAGACGG + Intergenic
924075059 1:240325036-240325058 CTGTGGTTGTAGAATGAAAAGGG + Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1068106995 10:52630899-52630921 ATGAGGTTTTTGAATTAAAATGG - Intergenic
1068537778 10:58259219-58259241 AAGGGTTTCTTGAAGAAAAACGG + Intronic
1070961511 10:80503097-80503119 CTGGGGGCCTTGAATAAGATGGG + Intronic
1071545597 10:86526621-86526643 GTGAGGATCCTGAATAAAAAAGG - Intergenic
1073852730 10:107639719-107639741 CTGGTCTGCCTGAATAAAAAAGG + Intergenic
1074030153 10:109679110-109679132 CTGAGTTTCTAGAATAAAGATGG + Intergenic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1077534225 11:3112321-3112343 CTGGGGTTCCTTAAAGAAAATGG + Intronic
1077719485 11:4613355-4613377 CTGGGGTGCTTGGAACAAAATGG - Intergenic
1078595997 11:12687351-12687373 CTGGGCTTCTTGGATAGGAAGGG + Intronic
1078986500 11:16604306-16604328 GTGGGTTTGGTGAATAAAAAAGG - Intronic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1079817455 11:25079518-25079540 CTGGGTTTATTGAATCAACATGG - Exonic
1082734091 11:56837468-56837490 CTGAGGTGGTTGAAGAAAAAGGG - Intergenic
1086002706 11:82000874-82000896 CTGGGGTTCTTGTATGGTAATGG + Intergenic
1088319038 11:108535840-108535862 CTGGGGGTCTGGAACAAGAAAGG + Intronic
1088449956 11:109970851-109970873 CTGGGGTTTTTGAATCTATAAGG + Intergenic
1091354318 11:134923936-134923958 CTGGAGGTATTGAATAAAGAGGG + Intergenic
1092170449 12:6370845-6370867 TTGGGGTTCTTGAACAATGAAGG - Intronic
1093272101 12:17076319-17076341 CTGGGTTTCTGTAAAAAAAAAGG + Intergenic
1093822483 12:23638296-23638318 CTGGGATTCTTGACTAACGATGG + Intronic
1093854553 12:24084729-24084751 CTGGAGTTCTAGAATAAAATGGG - Intergenic
1095931717 12:47634704-47634726 CTGGGATACTTGAGTCAAAAAGG - Intergenic
1096765225 12:53882154-53882176 CTGGGGATCTTGTTTAAAAGTGG - Intergenic
1098146823 12:67506061-67506083 CTGGCGTTCTTATTTAAAAAGGG + Intergenic
1100311758 12:93401942-93401964 GTGGGGTAGTTGAATAAAATTGG + Exonic
1100899164 12:99218627-99218649 CTTGGGTTCTGGAATCAAACTGG + Intronic
1103142839 12:118565303-118565325 CTGCAGCTCTTGCATAAAAAGGG - Intergenic
1103636656 12:122312799-122312821 CTGTGGTTCCTGGAGAAAAAGGG - Intronic
1105440002 13:20407159-20407181 AAGGGTTTCCTGAATAAAAATGG - Intronic
1108852385 13:54748478-54748500 CTCAAGTGCTTGAATAAAAATGG + Intergenic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1111803662 13:93011181-93011203 TTGGGGATTTTGAATAGAAAGGG - Intergenic
1112294301 13:98173085-98173107 CTGGGTATGTAGAATAAAAAAGG + Intronic
1112453600 13:99536056-99536078 CTCAGGTTATTCAATAAAAAAGG - Intronic
1112499835 13:99934289-99934311 CAGGGGTACTTTAATAAAAAGGG + Intergenic
1116375739 14:44198092-44198114 CTGGGGTTATTGAGTCAAACTGG - Intergenic
1119050767 14:71366046-71366068 CTGTGGTTCTTGAATAACCTGGG + Intronic
1124104180 15:26722045-26722067 CTGGGGCTCATTAAAAAAAATGG - Intronic
1124614495 15:31231610-31231632 GTGGGGTTCTGGACTAAAAAGGG + Intergenic
1125551444 15:40547850-40547872 CTGGGGTTCATGGAGAAAAGTGG - Intronic
1126155396 15:45560992-45561014 CTGTGGTTCTGGCATAAAGAAGG + Intergenic
1126708201 15:51427359-51427381 CTGGGGTTCCTTAAAGAAAATGG - Intergenic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1127371015 15:58341304-58341326 CTTGGATTCTTGAACGAAAATGG - Intronic
1127860240 15:62988068-62988090 CTGGGGTTCCTGGATCAGAAAGG - Intergenic
1129735957 15:77963655-77963677 CTGGGGATCTTGGATCATAATGG + Intergenic
1130418185 15:83714230-83714252 CTGGAGTTCTTCAATGAAACTGG + Intronic
1131105108 15:89728626-89728648 CTGGGTCTCTTAAATAAAAGAGG - Intronic
1133682737 16:8135565-8135587 GTGGGGTTCTTAAAAAAGAAAGG - Intergenic
1133918845 16:10133818-10133840 CAGGGGTTTTTGATTAAAAAAGG + Intronic
1136109337 16:28054881-28054903 CTGGGAGTTTTGAACAAAAATGG + Intronic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1140397016 16:74636207-74636229 CTGGGGTACTTGCATTAACAAGG + Intronic
1140407304 16:74719297-74719319 CTGGGGTCCTTGAGTCAAAATGG + Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1142828212 17:2528032-2528054 CTGGGGTCCTTGAATATGGATGG - Intergenic
1143801497 17:9386413-9386435 CTGGGGTGCTTGACTAGAAAGGG + Intronic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1149442960 17:56690624-56690646 GTGGGATTCTTGAAGACAAAGGG + Intergenic
1150327552 17:64268991-64269013 CTGAGGTTATTAAATATAAATGG + Intergenic
1150807727 17:68332353-68332375 CTGGGCATCTTGAAAAAAACAGG - Intronic
1151420661 17:73995059-73995081 CTGGAGTCCTTGAAAAAAGAGGG - Intergenic
1151543386 17:74776703-74776725 GTGGGGTTCTTGAGAAAAGAGGG + Intronic
1153170019 18:2305175-2305197 CTGTCTTTCTGGAATAAAAAGGG + Intergenic
1153891929 18:9525028-9525050 CTGGTGTTCTTGCTTTAAAATGG + Intronic
1155352632 18:24921840-24921862 CTGGGATTCCTTAATAAAATGGG + Intergenic
1158607430 18:58908005-58908027 CTGTGATTCTTAAATGAAAAGGG + Intronic
1159027553 18:63199835-63199857 CAGGGTTTCTTGATTGAAAAAGG - Intronic
1161325055 19:3659562-3659584 CTGGGGTTTTTGCCTAGAAATGG - Intronic
1161425764 19:4202196-4202218 CTAGGGTTCTGGAGTAAAAGGGG - Intronic
1162811020 19:13164347-13164369 TTGGGGTTCTTAAGTAAAACTGG - Intergenic
1164453351 19:28385839-28385861 CTGCTGTTCTTGAATAAACATGG - Intergenic
1164591165 19:29507772-29507794 TTGGGCTTCTTAAATTAAAATGG - Intergenic
1165053797 19:33160790-33160812 GTGGGGATCTTGAAGAAGAAGGG + Intronic
1168498947 19:56877243-56877265 CTGGGCTCCCTGAATAAGAATGG - Intergenic
927111127 2:19864401-19864423 CTTGGGGTCTTGAAGACAAATGG - Intergenic
927408621 2:22800303-22800325 CTGGGGGACTTGAAAGAAAATGG - Intergenic
928360462 2:30658442-30658464 CTGGCGTTCCTGACTAATAAAGG + Intergenic
931138851 2:59434982-59435004 CTCAGGTTCTTCAATAGAAAAGG + Intergenic
931151590 2:59580207-59580229 CTGGAGTCCTGGAAAAAAAACGG - Intergenic
931666048 2:64609970-64609992 CTGGGGTACTTTAATAAAAATGG + Intergenic
932071266 2:68622683-68622705 CTGGGGATATTTAATAAAAAAGG + Intronic
933269799 2:80221187-80221209 CTGGTAGTCTTTAATAAAAACGG - Intronic
936477389 2:112851233-112851255 CTGGGGTTCCTTAAAGAAAATGG + Intergenic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
938580095 2:132637965-132637987 GTGGTGATCTTGAATAAAGATGG + Intronic
939120869 2:138114617-138114639 CTTGGGTGCTGGAATAAAATGGG - Intergenic
939700216 2:145382109-145382131 CTGGGTTTCTTGTATAAACTTGG + Intergenic
943506160 2:188761173-188761195 ATGGGGCTCTTTAATAAAATTGG - Intronic
948310981 2:236986677-236986699 CTGGGCTTCTTCAAAAACAAAGG - Intergenic
1169643699 20:7784641-7784663 ATAGGGTTCTTCAATCAAAATGG - Intergenic
1172494575 20:35370470-35370492 CTGTGGCTAGTGAATAAAAAGGG - Intronic
1174684549 20:52441133-52441155 CTGGGATTCTTGAATCACCAAGG - Intergenic
1175238133 20:57526737-57526759 CTGGGGGGCTTGGATAAGAAGGG + Intergenic
1175340521 20:58226472-58226494 TTGGGGTTCTGGTATAAATAAGG + Intronic
1175847630 20:62066603-62066625 CTGGGTTTATTGATTAAAAATGG - Intergenic
1177357113 21:20022565-20022587 ATGGGATTCTGGAACAAAAAAGG - Intergenic
1177879810 21:26678851-26678873 CTTGAGTTCTTAAAGAAAAAAGG - Intergenic
1181589996 22:23878083-23878105 CTGGAGTTCTTGAGTAACAGTGG - Intronic
1182123961 22:27803208-27803230 CTAAGGTTTTTAAATAAAAAGGG - Intergenic
1184124397 22:42476803-42476825 CTGGAGTTTTTAAAGAAAAAAGG - Intergenic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
950918862 3:16672364-16672386 CTGGGGTTCCTTAAAGAAAATGG + Intergenic
952037950 3:29226127-29226149 CTTGGGTTCTAGAATCAAACTGG + Intergenic
953148570 3:40303111-40303133 GTGGGGTGCTTGAAGCAAAAAGG - Intergenic
954013168 3:47661454-47661476 CTCTGGTTCAAGAATAAAAATGG + Exonic
954032200 3:47827575-47827597 ATGGGTTTCCTGAATTAAAATGG + Intronic
956262802 3:67363705-67363727 CTGTGGTTTTTGAAAAAATATGG + Intronic
958464790 3:94443985-94444007 CTGGCTTTCTGAAATAAAAAAGG + Intergenic
965599088 3:170437682-170437704 GGGGCTTTCTTGAATAAAAATGG + Intronic
966709256 3:182953241-182953263 CAAGTGTTTTTGAATAAAAAAGG + Intronic
967148942 3:186630601-186630623 ATGGAGAGCTTGAATAAAAAAGG - Intergenic
967391135 3:188955911-188955933 CTGTCTTTCTTGCATAAAAAGGG + Intronic
968043104 3:195604605-195604627 CTGGGGTTCCTTAAAGAAAATGG + Intergenic
968823073 4:2870819-2870841 GTGGGGTAGTTGAATAAAATTGG + Intronic
969736371 4:8993543-8993565 CTGTGCTTCATGAAAAAAAAAGG - Intergenic
970028374 4:11648796-11648818 CTGGAGTTCTTATATAAAAAAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972354529 4:38268007-38268029 TTGTGGTTCTTTAATGAAAATGG + Intergenic
973297249 4:48538246-48538268 CTTCGTTTCTTTAATAAAAATGG - Intronic
973840031 4:54852037-54852059 CTGGGGCTCTTGAATACACTTGG - Intergenic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
974581801 4:63813530-63813552 CTGGGTTTCTGAAATAAAATAGG - Intergenic
975193000 4:71488383-71488405 ATAAGGTTCTTGAAAAAAAATGG + Intronic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
977283262 4:95068735-95068757 CTGGGGTTGTGAAATAACAAAGG - Intronic
978357232 4:107890249-107890271 CTGGGGTTCCTTAAAGAAAATGG - Intronic
978424320 4:108566371-108566393 CTGAAGTTCTTCAATAAAAAAGG + Intergenic
978768344 4:112428364-112428386 AATGGGGTCTTGAATAAAAATGG - Intronic
979580702 4:122355952-122355974 CTGTGGTTCTTGAACATGAATGG - Exonic
979784922 4:124704575-124704597 CTGAAGCTCTTGAATAAGAAAGG - Intronic
979910121 4:126354629-126354651 CTGGGCTTCTGTAATAGAAAAGG + Intergenic
981353799 4:143764047-143764069 CTGGGATCCTGGAATAGAAAAGG - Intergenic
982807139 4:159780299-159780321 CTGGGACTCTTGAATAAAAAAGG - Intergenic
983748158 4:171227977-171227999 CTGGAGTTCTTGAAAAAATCAGG - Intergenic
984031341 4:174607574-174607596 CTGGGGTTCCTTAAGGAAAATGG + Intergenic
984170775 4:176356934-176356956 CTGGGGTTCCTTAAAGAAAATGG - Intergenic
985012453 4:185597834-185597856 CTTGGGAACTTGGATAAAAAGGG - Intronic
986691395 5:10316580-10316602 CTGTGGTTTTTGAATAGGAATGG - Intergenic
987374867 5:17224471-17224493 GGGGGGCTCTTGAATAAAATGGG + Intronic
987378764 5:17263573-17263595 CTGGGCTTCATGAAGAATAATGG + Intronic
989401155 5:41009006-41009028 TTGGGGTTTTTCAACAAAAAGGG + Intronic
989658589 5:43773135-43773157 GTGGGGTTGTAGAATGAAAATGG + Intergenic
989660671 5:43793847-43793869 ATGGGTTTCCTGAATAAAATGGG - Intergenic
992038916 5:72809123-72809145 CTGGGTTTCATGCATAAAACTGG - Intergenic
992380312 5:76229705-76229727 CTGGGGGGCTTGCATAACAAGGG + Intronic
994981863 5:106885534-106885556 CTGGGATTCTGGAACAGAAATGG + Intergenic
997019114 5:129976066-129976088 CTGATCTTCTTGAATAAAACTGG - Intronic
997720840 5:136077398-136077420 CTGAGGCTCTTGAATTAAGATGG + Intergenic
998066127 5:139160528-139160550 CTGAAATTCTTGCATAAAAAAGG + Intronic
998667927 5:144319769-144319791 CTGTGTTGCTTGAGTAAAAATGG + Intronic
1000141846 5:158412534-158412556 CTGCGATTTTTGAATCAAAATGG + Intergenic
1000573490 5:162945441-162945463 CTAGGGTTATAGAATAAATATGG + Intergenic
1004136922 6:12976354-12976376 CTGGGATCTTAGAATAAAAAGGG + Intronic
1005370815 6:25130574-25130596 CTGGGGTTCCTTAAAGAAAATGG + Intergenic
1008650605 6:53557412-53557434 CTGGGGTTCCTTAAGGAAAATGG + Intronic
1009720723 6:67465896-67465918 GTGGGGTTATTGAGAAAAAAAGG + Intergenic
1011335638 6:86256656-86256678 CTGGGATTCTTTGATAATAATGG - Intergenic
1011349625 6:86408265-86408287 GTGGGTTGCTTGAATAGAAATGG - Intergenic
1013332730 6:109121739-109121761 TTGGGGTTCTTGTTTTAAAATGG + Intronic
1013922894 6:115430811-115430833 ATGGGGTTCATGAATAACACTGG - Intergenic
1014784491 6:125602123-125602145 CTTGGGTACTTTAACAAAAATGG - Intergenic
1018283702 6:162215255-162215277 CTGGTGTTGATGAATAAAAACGG + Intronic
1018538428 6:164849382-164849404 ATAGGGTACTTAAATAAAAATGG + Intergenic
1018950573 6:168376115-168376137 CTGGGGTTCTTATTTGAAAATGG + Intergenic
1020924641 7:14310306-14310328 CAGGGATTCTTGAATAAAAATGG + Intronic
1021915762 7:25430803-25430825 CTGTGGTTCTTTAATCACAATGG - Intergenic
1021968211 7:25942970-25942992 CTGGAGGTCTTGAAAAAACAAGG + Intergenic
1022595396 7:31708865-31708887 ATGGAGTGCTGGAATAAAAAAGG - Intergenic
1024058174 7:45679493-45679515 CTGGGGTTCCTGAGTAAGAAGGG - Intronic
1024435151 7:49343436-49343458 CTGGAGTTCTAGAACAAAAAGGG + Intergenic
1028639294 7:93025113-93025135 CTGGGATCATTCAATAAAAATGG + Intergenic
1030319274 7:108146924-108146946 CTGGGGCTCTTTAGCAAAAAGGG - Intergenic
1030639965 7:111993425-111993447 CTGGGGTTCTGGTATGAATATGG - Intronic
1031259891 7:119505684-119505706 CTGGGGTTCTTGATTACATCAGG + Intergenic
1037071967 8:14661700-14661722 CTTGGGTTCTTGGATCAAAAAGG + Intronic
1037487251 8:19359141-19359163 CTAGCTTTCTTGAATAAATACGG + Intronic
1038736871 8:30177988-30178010 CTGGGGTTCTTGAATCAAGAAGG - Intronic
1041987613 8:63944272-63944294 TTGGGGTTCTTGAAGAAGGAAGG - Intergenic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1043640558 8:82444859-82444881 CTGTGGTGCTAGAATAAAAAAGG + Intergenic
1043645759 8:82516685-82516707 CTTGTGTTCTTGTATGAAAATGG - Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044497596 8:92906471-92906493 CTAAGGTTCTTGAATTAAGAAGG + Intronic
1045144276 8:99322391-99322413 CTTGAGTTCTTGAAAACAAACGG - Intronic
1047388339 8:124430187-124430209 CTGAGATTCATGAATTAAAAGGG + Intergenic
1050271689 9:3952613-3952635 CTGGGATTGATGAATAATAATGG + Intronic
1050401593 9:5261953-5261975 CTGGGGTTCGTGAGGAAAACAGG + Intergenic
1050772967 9:9226524-9226546 GAGGGGTAATTGAATAAAAATGG + Intronic
1051037268 9:12763431-12763453 CTGGGGATTTTGACTAGAAAGGG + Intergenic
1051811219 9:21052388-21052410 CTGGGGTTCTTATAAGAAAAGGG - Intergenic
1053434456 9:38066354-38066376 CTGGAGGTCTTGTATATAAAAGG - Intronic
1056201597 9:84282248-84282270 GTGGGGTTGTTGACTACAAATGG + Intronic
1059120181 9:111634570-111634592 CAGTGGCTCTGGAATAAAAACGG + Intronic
1059306026 9:113353908-113353930 CTGGGGTTCTGGGATGAAGACGG + Intronic
1186843458 X:13508164-13508186 CTGGGTTTCTTTAATGCAAATGG + Intergenic
1187696441 X:21926469-21926491 CTTGGATTCTTGCACAAAAAAGG + Intergenic
1189182756 X:39019008-39019030 CTGGGGCTCTTGGAAAAAGAGGG + Intergenic
1190401992 X:50046480-50046502 CTCTGTTTCTTGAATATAAAAGG - Intronic
1190622605 X:52302562-52302584 GTGGAGTGGTTGAATAAAAAAGG - Intergenic
1194451488 X:94049273-94049295 CTGGGGTTCCTTAAAGAAAATGG - Intergenic
1197265096 X:124360891-124360913 CTGGGGATCTAGAATCAAATGGG + Intronic
1197501001 X:127242573-127242595 CAGGGGTCCATGAATCAAAAAGG + Intergenic
1197985560 X:132263240-132263262 TTGGAGTTCCAGAATAAAAAGGG + Intergenic
1199887779 X:152039190-152039212 CTGGGATTCTTTAAAGAAAATGG - Intergenic