ID: 973918211

View in Genome Browser
Species Human (GRCh38)
Location 4:55657764-55657786
Sequence TAGAATATGCTGAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973918201_973918211 19 Left 973918201 4:55657722-55657744 CCTCAGGCAAAGAGGTGCAGGTA No data
Right 973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG No data
973918197_973918211 28 Left 973918197 4:55657713-55657735 CCAAAATGCCCTCAGGCAAAGAG No data
Right 973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG No data
973918205_973918211 -4 Left 973918205 4:55657745-55657767 CCCGCAGCTGGAAGTGGGCTAGA No data
Right 973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG No data
973918206_973918211 -5 Left 973918206 4:55657746-55657768 CCGCAGCTGGAAGTGGGCTAGAA No data
Right 973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG No data
973918200_973918211 20 Left 973918200 4:55657721-55657743 CCCTCAGGCAAAGAGGTGCAGGT No data
Right 973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG No data
973918196_973918211 29 Left 973918196 4:55657712-55657734 CCCAAAATGCCCTCAGGCAAAGA No data
Right 973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973918211 Original CRISPR TAGAATATGCTGAAGGGGCA GGG Intergenic
No off target data available for this crispr