ID: 973918400

View in Genome Browser
Species Human (GRCh38)
Location 4:55659885-55659907
Sequence CAGGGGACTCTAGAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973918400_973918406 11 Left 973918400 4:55659885-55659907 CCATTCTCCTCTAGAGTCCCCTG No data
Right 973918406 4:55659919-55659941 TGTGCAAAGTAGGTGCTCAGTGG No data
973918400_973918405 1 Left 973918400 4:55659885-55659907 CCATTCTCCTCTAGAGTCCCCTG No data
Right 973918405 4:55659909-55659931 CACTCTGACTTGTGCAAAGTAGG No data
973918400_973918407 14 Left 973918400 4:55659885-55659907 CCATTCTCCTCTAGAGTCCCCTG No data
Right 973918407 4:55659922-55659944 GCAAAGTAGGTGCTCAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973918400 Original CRISPR CAGGGGACTCTAGAGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr