ID: 973919462

View in Genome Browser
Species Human (GRCh38)
Location 4:55670265-55670287
Sequence AGTTCTCTGCAGACACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973919459_973919462 -9 Left 973919459 4:55670251-55670273 CCAAGCAATTCCCTAGTTCTCTG No data
Right 973919462 4:55670265-55670287 AGTTCTCTGCAGACACTGACTGG No data
973919457_973919462 20 Left 973919457 4:55670222-55670244 CCACCAATTGTGTAGGGATCTTT No data
Right 973919462 4:55670265-55670287 AGTTCTCTGCAGACACTGACTGG No data
973919458_973919462 17 Left 973919458 4:55670225-55670247 CCAATTGTGTAGGGATCTTTTTC No data
Right 973919462 4:55670265-55670287 AGTTCTCTGCAGACACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973919462 Original CRISPR AGTTCTCTGCAGACACTGAC TGG Intergenic
No off target data available for this crispr