ID: 973919938 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:55674326-55674348 |
| Sequence | AAGGAGAGTACAGTGATTGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973919938_973919946 | 24 | Left | 973919938 | 4:55674326-55674348 | CCCACAATCACTGTACTCTCCTT | No data | ||
| Right | 973919946 | 4:55674373-55674395 | CAGTGATATGAAGTTCAACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973919938 | Original CRISPR | AAGGAGAGTACAGTGATTGT GGG (reversed) | Intergenic | ||