ID: 973919938

View in Genome Browser
Species Human (GRCh38)
Location 4:55674326-55674348
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 2, 1: 15, 2: 65, 3: 167, 4: 386}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973919938_973919946 24 Left 973919938 4:55674326-55674348 CCCACAATCACTGTACTCTCCTT 0: 2
1: 15
2: 65
3: 167
4: 386
Right 973919946 4:55674373-55674395 CAGTGATATGAAGTTCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973919938 Original CRISPR AAGGAGAGTACAGTGATTGT GGG (reversed) Intergenic
900759652 1:4462232-4462254 AAGGAAAGTAAAGTGAGTGGTGG - Intergenic
902157696 1:14502950-14502972 CAGGAGAGAAGAATGATTGTGGG - Intergenic
904481211 1:30794668-30794690 AATGGTAGTACACTGATTGTGGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908022732 1:59915127-59915149 CAGGAGAGCAGAGTGATAGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908478865 1:64517418-64517440 AAGGAGAATTAAGTGAGTGTGGG + Intronic
909235718 1:73150986-73151008 AAGGAGAGTATATCGTTTGTAGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910321685 1:85953061-85953083 ATGGAGAATACATTGCTTGTTGG - Intronic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910800391 1:91139059-91139081 AAGGAGAGTCCAGAGAGTGGTGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911728847 1:101270765-101270787 AATGAGAGTACAAAGATTATAGG + Intergenic
912046684 1:105467866-105467888 AAAGAGAGTACAGTGTATTTTGG + Intergenic
912230564 1:107787950-107787972 AAGGAGAGGAGTGGGATTGTGGG - Intronic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918402634 1:184178720-184178742 AAGGAGATCAGAGGGATTGTTGG - Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919098785 1:193068186-193068208 AAGGAGAGCACCATGATTATTGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923575486 1:235154909-235154931 AATGAGAGAACTGTGTTTGTTGG - Exonic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066556906 10:36624241-36624263 AAGTAGAGTAGAGAGATTGGGGG - Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069729679 10:70602620-70602642 AAGGAGAGAGCAGGGATTGGGGG - Intronic
1069734889 10:70647569-70647591 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1070409390 10:76125600-76125622 AACCAGAGTACAGTGAAGGTAGG + Intronic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071935635 10:90527061-90527083 AGGGAGAGTACAGGATTTGTGGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073353683 10:102837132-102837154 ACCAAGACTACAGTGATTGTCGG - Exonic
1073650404 10:105352543-105352565 ACAGAGAGTACAGTGGTGGTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075904743 10:126071486-126071508 AAGGAGAGGAGTGTGACTGTGGG - Exonic
1076242795 10:128922450-128922472 TTGGAGAATACAGTGATTCTGGG - Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077577476 11:3395562-3395584 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077603975 11:3594680-3594702 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081282497 11:41226975-41226997 AAGCAGAGGACTGTGGTTGTGGG - Intronic
1082250692 11:49976819-49976841 AAGGTGAGAGCAGTGCTTGTAGG + Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084110266 11:67009752-67009774 AAGGAGAGTCCAGCTATTGTGGG + Intronic
1084226427 11:67717497-67717519 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084229427 11:67740344-67740366 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084259872 11:67969272-67969294 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084812899 11:71625980-71626002 AAGGGCAGTTCAGTGAATGTAGG + Intergenic
1084845871 11:71899352-71899374 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087102734 11:94380843-94380865 AAGGAGAGGCCAGTGCTTCTTGG - Intronic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088803960 11:113333798-113333820 AAAGAGAGAACAATAATTGTTGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089474842 11:118751004-118751026 AAGGGGATTAGAGTGATTATGGG - Exonic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090292298 11:125555928-125555950 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1092434077 12:8432434-8432456 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1092681854 12:10992128-10992150 AAGCAGAGTTCAATGATTGAAGG + Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095196362 12:39323266-39323288 CAGGAGAGCACAGTAAATGTTGG - Intronic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099523213 12:83689423-83689445 AAAGACAGTGCGGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101244578 12:102873390-102873412 AAGGAGGGTACAGCCATTGGTGG + Intronic
1106141061 13:27012066-27012088 AAGGAGAGTGAAGTGAATGGAGG + Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111296012 13:86278664-86278686 AAGGAGATTAGAGTGATTATAGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111351813 13:87041235-87041257 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115181106 14:30626665-30626687 TAGGAGAGTCCAGTGACAGTGGG - Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119648559 14:76366911-76366933 ACAGTGAGTACAGTGATTGATGG - Intronic
1119753158 14:77095031-77095053 AAAGAGAGTAAAGTGAGTGAAGG + Intergenic
1120344522 14:83268772-83268794 AAAGAAAGAACAGTGAGTGTGGG - Intergenic
1121509069 14:94498941-94498963 AAGGAGAGGAGAGTGATAGAGGG + Intronic
1123136409 14:106031449-106031471 TAGGAGAGTAGGGTGATAGTGGG + Intergenic
1123985279 15:25640427-25640449 AAGGGGGGAACAGTGATTATAGG + Intergenic
1124582594 15:30973289-30973311 TAGCAGAGTAGAGTGGTTGTAGG - Intronic
1125920124 15:43520419-43520441 AAGGAGAGGACAGCCAGTGTGGG + Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1130275806 15:82475842-82475864 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130468165 15:84203234-84203256 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130496099 15:84470308-84470330 AAGGAGACCACAGTGCTTGCTGG - Intergenic
1130590458 15:85207832-85207854 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132175110 15:99707518-99707540 AAGAATATTACAGTGATCGTAGG + Intronic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1135423243 16:22318440-22318462 GAGCAGAGCACAGTGATTGAGGG + Intronic
1135821284 16:25688753-25688775 AAGGACAGTACAGTGTGTGGTGG - Intergenic
1137329850 16:47482324-47482346 AAGGACAGTACAGAGTTTGTAGG - Intronic
1138748312 16:59389413-59389435 AAGGAGGGCACAGTGCATGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1142405619 16:89887545-89887567 AAGGAGAGAACACGGATTTTTGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143418444 17:6768965-6768987 AAGGAGAGTTGAGAGAATGTGGG - Intronic
1145067807 17:19773936-19773958 AAGGAGGGGACAGGGACTGTGGG + Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1147503802 17:40993704-40993726 AAGCAGAGTACATTAGTTGTAGG + Exonic
1148680522 17:49470912-49470934 AATGACAGTACAGGGATTCTTGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1153326559 18:3826629-3826651 AAGGTGAGGACAGTGATTTGGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158225113 18:55192745-55192767 AAGGAGATTAAAGTGACTGAGGG + Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159513600 18:69428732-69428754 AAGGAGAATAGAGAGGTTGTTGG - Intronic
1159566193 18:70053304-70053326 AAGGAGTGAACATTGATTCTGGG - Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925699059 2:6614370-6614392 ACGGAGAGTGCTGTGAGTGTGGG - Intergenic
926000449 2:9327369-9327391 AAGGAAAATAATGTGATTGTTGG - Intronic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
928982085 2:37146481-37146503 AAAGAGATGAAAGTGATTGTAGG - Intronic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930049357 2:47202657-47202679 AAATAGAGTCTAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930588326 2:53296919-53296941 ATGGAGAGTACAAGGATGGTTGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932101144 2:68900382-68900404 AAGGACAGCAAGGTGATTGTAGG + Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
934766032 2:96880569-96880591 AAGGAGAATACAATGAGAGTTGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
936498312 2:113042612-113042634 AAGGAAAGTACACTGAGTGAAGG - Intronic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938120102 2:128627069-128627091 AAGAAGAGACCAGTGATTCTTGG - Intergenic
938648976 2:133361156-133361178 AAGTAGGGTACATTGGTTGTGGG - Intronic
938821693 2:134966876-134966898 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
939437641 2:142199360-142199382 AAGGAGACTACTGCCATTGTTGG - Intergenic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942399361 2:175585047-175585069 AAGGAGAGTACAGATATTGAGGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944753546 2:202736316-202736338 GATGAGAGGACAGTGATTGCTGG + Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944928906 2:204495822-204495844 AAGGAAAAAAGAGTGATTGTGGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948103043 2:235390546-235390568 TAGGAGAGTCAAGTGAATGTGGG - Intergenic
948306068 2:236947821-236947843 AAACACAGTACAGTGATGGTAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170062648 20:12275854-12275876 AAGAAGAGTACAATTATTGTAGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170613860 20:17934090-17934112 AAGGAGAGTCCAGTTAGTGAAGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG + Intergenic
1173632300 20:44525834-44525856 AAGGAGAATACAGAGTTGGTGGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1179101825 21:38361054-38361076 AAGCAGAGGACAGTGACTGAGGG - Intergenic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1182399155 22:30061191-30061213 AAGAAGAGAACAGTCCTTGTGGG - Intergenic
1183552563 22:38499450-38499472 AAGGAGATTACAGTGAGGGGGGG - Exonic
1185053776 22:48567479-48567501 AAGGAGAGCAGGGTGATCGTGGG + Intronic
949701301 3:6762195-6762217 AAGGAGAGAACAGGGATAGCAGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951837248 3:26996923-26996945 CAGGAGAGTCCAGTGGTGGTGGG + Intergenic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
954137361 3:48588193-48588215 TAGGCGAGGACAGTGATGGTGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957074826 3:75593695-75593717 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
957219061 3:77358905-77358927 AAGATGAGCACAGTCATTGTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957486029 3:80864337-80864359 AAGGGGAGTGCAGGGGTTGTGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959361493 3:105399319-105399341 AAAGCTAGTGCAGTGATTGTTGG + Intronic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961033652 3:123627377-123627399 CATGAAAGTTCAGTGATTGTCGG - Intronic
961044194 3:123697636-123697658 GTGGACAGTACAGTCATTGTTGG + Intronic
961276380 3:125730436-125730458 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
961875118 3:130016582-130016604 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
961878057 3:130039294-130039316 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
961929691 3:130519947-130519969 AAGGAGATTACAATGTTTGGCGG - Intergenic
962638917 3:137362309-137362331 AAGCAGAGTAAAGTAATTGTGGG - Intergenic
962674923 3:137748754-137748776 AAGAAGAGTTCAATTATTGTTGG + Intergenic
962938298 3:140101929-140101951 TAGGAGAGTACAGGGATGTTTGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963251176 3:143104837-143104859 AAGGAGGGTACAGTGATCCAAGG + Intergenic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964179222 3:153864281-153864303 AAGGAAAGCACAGTGATTTAGGG + Intergenic
964216188 3:154286195-154286217 ATTGAGAGTAAAGTGTTTGTTGG - Intronic
964253588 3:154749446-154749468 AAGGAGAATGCAATGATTATGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967463915 3:189780305-189780327 AAGAAGGGTACAGTGATTTGGGG - Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968005120 3:195237362-195237384 AAGGAGAGTGCAGCAGTTGTGGG - Intronic
968990272 4:3906330-3906352 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969018426 4:4121333-4121355 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969023114 4:4151520-4151542 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969730695 4:8955563-8955585 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969735557 4:8987385-8987407 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969794777 4:9518840-9518862 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
970363688 4:15336788-15336810 GAGGAGAGGACATTGATTCTTGG - Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972579054 4:40379169-40379191 GAGGACAGTGCAGTGATTATGGG + Intergenic
973255816 4:48112152-48112174 AATGAGAGAACAGTGATTTCAGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974266905 4:59597704-59597726 AAGGATAGTGCAGGGACTGTGGG + Intergenic
974877136 4:67714582-67714604 ATGGTGGGGACAGTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
976762888 4:88569267-88569289 AAGGAGAGTGCCGGGATTGTGGG - Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
977632137 4:99254897-99254919 AAGGAGAGTAGAATGAGTGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977841775 4:101715574-101715596 AAGAAGCCTACAGGGATTGTGGG + Intronic
977992748 4:103464610-103464632 AATGAGAGGACAGTGAGTGATGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979015644 4:115430006-115430028 TAGGAGAGAACAGTAATTGAAGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980646581 4:135651331-135651353 ACAGAGGGTGCAGTGATTGTGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980748303 4:137051628-137051650 AAGGAGAGTACTGAAAATGTGGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
982098049 4:151941486-151941508 AAGGAGAGAACAAATATTGTTGG + Intergenic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982690019 4:158538051-158538073 CAAGAGAGAACAGTGTTTGTAGG + Intronic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982911454 4:161148057-161148079 AGGAAGAGTACATTGACTGTAGG + Intergenic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986621412 5:9679528-9679550 AACTAGAGTACAGTGTTTATGGG - Intronic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
989127926 5:38074874-38074896 AAGAAGAGTTCAGTGAATATTGG - Intergenic
989366021 5:40656704-40656726 AAGGAGAGTACTGAAAATGTGGG + Intergenic
991151359 5:63375017-63375039 AAGGATAATACTGTGATTGCAGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993107114 5:83612054-83612076 AAGGAGACTTCAGTGCCTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
993999070 5:94756303-94756325 AAGAAGTCTTCAGTGATTGTTGG + Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995264709 5:110144686-110144708 AAGGAGAAGACAGTGATTAGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002276122 5:178105279-178105301 AAGGAGAGAGCGGTGCTTGTGGG + Intergenic
1005571897 6:27153347-27153369 AAGAAGAGGACAGTGAATCTAGG + Intergenic
1005793155 6:29328261-29328283 AAGGGGATTAGAGTGATTATGGG - Intergenic
1006656693 6:35600695-35600717 AAGGAGAGTACATTTAGTGGGGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1008333070 6:50265673-50265695 AAGGAAAGTACAATCATTATGGG + Intergenic
1008504341 6:52214901-52214923 AAGGACAGTAAATTGATTATAGG + Intergenic
1009026776 6:58009561-58009583 AAGAAGAGTAAAGGTATTGTGGG + Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011029163 6:82902581-82902603 AAGGACAGAGCAGTGATTGCAGG + Intronic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1013996967 6:116320481-116320503 AAGGAGAGAACAGTGCAGGTTGG + Intronic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016119011 6:140324760-140324782 ATGGAGATTACAATGATTTTAGG + Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016354084 6:143198892-143198914 AAGGAGAAAAGAGAGATTGTGGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016511511 6:144848395-144848417 AAAGTGAGTACAGTGATTCAAGG + Intronic
1017281036 6:152626197-152626219 ATGAAGAGTAGAGTGTTTGTAGG + Intronic
1019635354 7:2072658-2072680 AAGCAGAGTACAGGGAATGGTGG - Intronic
1020310164 7:6861244-6861266 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020313102 7:6884384-6884406 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020882392 7:13778449-13778471 AAGTAGAGAACAATGATTATAGG + Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023227052 7:37981648-37981670 AAAAAAAGTACAGTCATTGTAGG + Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025908835 7:65811118-65811140 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1025980033 7:66397810-66397832 CAGGAGAGTACTGTGAATGTGGG - Intronic
1026043502 7:66888322-66888344 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1027204909 7:76090149-76090171 CAGGAGAGTACTGTGAATGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027889738 7:83956543-83956565 AAGGAAGGTAAAGAGATTGTGGG + Exonic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028284715 7:88981787-88981809 GAGGAGAGCACAGTGATCTTGGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029076914 7:97942041-97942063 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035495127 7:159318372-159318394 AAGAAGAATACAATGATTGGTGG - Intergenic
1035517275 8:246127-246149 AAGGACAGAAGAGTGATTGAAGG - Exonic
1036240862 8:7079927-7079949 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
1036902292 8:12679428-12679450 AAGGGCAGTTCAGTGAATGTAGG - Intergenic
1038067273 8:23975996-23976018 CTGGAGAGGACAGTGTTTGTGGG + Intergenic
1038097511 8:24331296-24331318 TGGGAGAGGACTGTGATTGTGGG + Exonic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1044149320 8:88754849-88754871 AAGGACAATTCAGTGAGTGTGGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044560060 8:93604068-93604090 AAGTAGATTAAGGTGATTGTGGG - Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044987900 8:97771157-97771179 AAGGAGAGTTCAGAGATTAGAGG + Intergenic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052246116 9:26337407-26337429 AAGGGAAGTTCAGTGGTTGTTGG + Intergenic
1053017123 9:34668235-34668257 AAGAAGAGAACAGTGCATGTGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055705438 9:78995527-78995549 AATTAGATAACAGTGATTGTTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057084509 9:92196686-92196708 AAGGAAAGTGAAGTGAGTGTAGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1059910672 9:119040559-119040581 AAGGAGGGGACAGTGGTGGTTGG - Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060624185 9:125095489-125095511 AAGGAGAGAACACGTATTGTAGG - Intronic
1061502608 9:131012659-131012681 AAGGAGAGGCCTGGGATTGTCGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185755848 X:2652309-2652331 AAGGAGACTACAGTGTTTGGGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188112782 X:26211857-26211879 AACTTGAGTACAGAGATTGTGGG + Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1190648280 X:52543742-52543764 AAGCAGAGGACAGTGAGTGCAGG + Intergenic
1192223233 X:69211505-69211527 AAGGTGAGTCCAGTGAGGGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193092432 X:77509625-77509647 GAAAAGAGTACAGTGATTATGGG + Intronic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196025063 X:111033434-111033456 AAGGTGAGTGCAGTCAATGTGGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic