ID: 973919939

View in Genome Browser
Species Human (GRCh38)
Location 4:55674327-55674349
Sequence GAAGGAGAGTACAGTGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973919939_973919946 23 Left 973919939 4:55674327-55674349 CCACAATCACTGTACTCTCCTTC No data
Right 973919946 4:55674373-55674395 CAGTGATATGAAGTTCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973919939 Original CRISPR GAAGGAGAGTACAGTGATTG TGG (reversed) Intergenic