ID: 973919941

View in Genome Browser
Species Human (GRCh38)
Location 4:55674349-55674371
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973919941_973919946 1 Left 973919941 4:55674349-55674371 CCCCTAAGCACATATCTCCTCCT No data
Right 973919946 4:55674373-55674395 CAGTGATATGAAGTTCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973919941 Original CRISPR AGGAGGAGATATGTGCTTAG GGG (reversed) Intergenic