ID: 973919946

View in Genome Browser
Species Human (GRCh38)
Location 4:55674373-55674395
Sequence CAGTGATATGAAGTTCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973919938_973919946 24 Left 973919938 4:55674326-55674348 CCCACAATCACTGTACTCTCCTT No data
Right 973919946 4:55674373-55674395 CAGTGATATGAAGTTCAACCAGG No data
973919941_973919946 1 Left 973919941 4:55674349-55674371 CCCCTAAGCACATATCTCCTCCT No data
Right 973919946 4:55674373-55674395 CAGTGATATGAAGTTCAACCAGG No data
973919942_973919946 0 Left 973919942 4:55674350-55674372 CCCTAAGCACATATCTCCTCCTT No data
Right 973919946 4:55674373-55674395 CAGTGATATGAAGTTCAACCAGG No data
973919940_973919946 5 Left 973919940 4:55674345-55674367 CCTTCCCCTAAGCACATATCTCC No data
Right 973919946 4:55674373-55674395 CAGTGATATGAAGTTCAACCAGG No data
973919939_973919946 23 Left 973919939 4:55674327-55674349 CCACAATCACTGTACTCTCCTTC No data
Right 973919946 4:55674373-55674395 CAGTGATATGAAGTTCAACCAGG No data
973919943_973919946 -1 Left 973919943 4:55674351-55674373 CCTAAGCACATATCTCCTCCTTC No data
Right 973919946 4:55674373-55674395 CAGTGATATGAAGTTCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973919946 Original CRISPR CAGTGATATGAAGTTCAACC AGG Intergenic