ID: 973920638

View in Genome Browser
Species Human (GRCh38)
Location 4:55681566-55681588
Sequence CTCCAGCAGGACTGAGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973920638_973920644 4 Left 973920638 4:55681566-55681588 CCTGTGACTCAGTCCTGCTGGAG No data
Right 973920644 4:55681593-55681615 GTGGTAGCCAGGCTCCAGGATGG No data
973920638_973920647 19 Left 973920638 4:55681566-55681588 CCTGTGACTCAGTCCTGCTGGAG No data
Right 973920647 4:55681608-55681630 CAGGATGGCCCCAATGAGCCCGG No data
973920638_973920641 -7 Left 973920638 4:55681566-55681588 CCTGTGACTCAGTCCTGCTGGAG No data
Right 973920641 4:55681582-55681604 GCTGGAGACCTGTGGTAGCCAGG No data
973920638_973920642 0 Left 973920638 4:55681566-55681588 CCTGTGACTCAGTCCTGCTGGAG No data
Right 973920642 4:55681589-55681611 ACCTGTGGTAGCCAGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973920638 Original CRISPR CTCCAGCAGGACTGAGTCAC AGG (reversed) Intergenic
No off target data available for this crispr