ID: 973920640

View in Genome Browser
Species Human (GRCh38)
Location 4:55681579-55681601
Sequence GGCTACCACAGGTCTCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973920640_973920647 6 Left 973920640 4:55681579-55681601 CCTGCTGGAGACCTGTGGTAGCC No data
Right 973920647 4:55681608-55681630 CAGGATGGCCCCAATGAGCCCGG No data
973920640_973920644 -9 Left 973920640 4:55681579-55681601 CCTGCTGGAGACCTGTGGTAGCC No data
Right 973920644 4:55681593-55681615 GTGGTAGCCAGGCTCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973920640 Original CRISPR GGCTACCACAGGTCTCCAGC AGG (reversed) Intergenic
No off target data available for this crispr