ID: 973920643

View in Genome Browser
Species Human (GRCh38)
Location 4:55681590-55681612
Sequence TCCTGGAGCCTGGCTACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973920643_973920647 -5 Left 973920643 4:55681590-55681612 CCTGTGGTAGCCAGGCTCCAGGA No data
Right 973920647 4:55681608-55681630 CAGGATGGCCCCAATGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973920643 Original CRISPR TCCTGGAGCCTGGCTACCAC AGG (reversed) Intergenic
No off target data available for this crispr