ID: 973920647

View in Genome Browser
Species Human (GRCh38)
Location 4:55681608-55681630
Sequence CAGGATGGCCCCAATGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973920638_973920647 19 Left 973920638 4:55681566-55681588 CCTGTGACTCAGTCCTGCTGGAG No data
Right 973920647 4:55681608-55681630 CAGGATGGCCCCAATGAGCCCGG No data
973920640_973920647 6 Left 973920640 4:55681579-55681601 CCTGCTGGAGACCTGTGGTAGCC No data
Right 973920647 4:55681608-55681630 CAGGATGGCCCCAATGAGCCCGG No data
973920643_973920647 -5 Left 973920643 4:55681590-55681612 CCTGTGGTAGCCAGGCTCCAGGA No data
Right 973920647 4:55681608-55681630 CAGGATGGCCCCAATGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973920647 Original CRISPR CAGGATGGCCCCAATGAGCC CGG Intergenic
No off target data available for this crispr