ID: 973924213

View in Genome Browser
Species Human (GRCh38)
Location 4:55720579-55720601
Sequence TCAGCTCCAGGTAAGATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973924213_973924217 30 Left 973924213 4:55720579-55720601 CCATTTATCTTACCTGGAGCTGA No data
Right 973924217 4:55720632-55720654 GAAGCTGAGAATGATGTCTTGGG No data
973924213_973924216 29 Left 973924213 4:55720579-55720601 CCATTTATCTTACCTGGAGCTGA No data
Right 973924216 4:55720631-55720653 AGAAGCTGAGAATGATGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973924213 Original CRISPR TCAGCTCCAGGTAAGATAAA TGG (reversed) Intergenic
No off target data available for this crispr