ID: 973926419

View in Genome Browser
Species Human (GRCh38)
Location 4:55743087-55743109
Sequence CTGGCTCTCCCCTGCCTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973926419_973926424 -4 Left 973926419 4:55743087-55743109 CCCCGAAGGCAGGGGAGAGCCAG No data
Right 973926424 4:55743106-55743128 CCAGCCACACAGCTGTGTGTGGG No data
973926419_973926430 27 Left 973926419 4:55743087-55743109 CCCCGAAGGCAGGGGAGAGCCAG No data
Right 973926430 4:55743137-55743159 GCTGAGAGGAGCCGCAGGGCTGG No data
973926419_973926426 13 Left 973926419 4:55743087-55743109 CCCCGAAGGCAGGGGAGAGCCAG No data
Right 973926426 4:55743123-55743145 TGTGGGAGCCAGCTGCTGAGAGG No data
973926419_973926428 22 Left 973926419 4:55743087-55743109 CCCCGAAGGCAGGGGAGAGCCAG No data
Right 973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG No data
973926419_973926422 -5 Left 973926419 4:55743087-55743109 CCCCGAAGGCAGGGGAGAGCCAG No data
Right 973926422 4:55743105-55743127 GCCAGCCACACAGCTGTGTGTGG No data
973926419_973926429 23 Left 973926419 4:55743087-55743109 CCCCGAAGGCAGGGGAGAGCCAG No data
Right 973926429 4:55743133-55743155 AGCTGCTGAGAGGAGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973926419 Original CRISPR CTGGCTCTCCCCTGCCTTCG GGG (reversed) Intergenic
No off target data available for this crispr