ID: 973926420

View in Genome Browser
Species Human (GRCh38)
Location 4:55743088-55743110
Sequence GCTGGCTCTCCCCTGCCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973926420_973926428 21 Left 973926420 4:55743088-55743110 CCCGAAGGCAGGGGAGAGCCAGC No data
Right 973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG No data
973926420_973926426 12 Left 973926420 4:55743088-55743110 CCCGAAGGCAGGGGAGAGCCAGC No data
Right 973926426 4:55743123-55743145 TGTGGGAGCCAGCTGCTGAGAGG No data
973926420_973926430 26 Left 973926420 4:55743088-55743110 CCCGAAGGCAGGGGAGAGCCAGC No data
Right 973926430 4:55743137-55743159 GCTGAGAGGAGCCGCAGGGCTGG No data
973926420_973926424 -5 Left 973926420 4:55743088-55743110 CCCGAAGGCAGGGGAGAGCCAGC No data
Right 973926424 4:55743106-55743128 CCAGCCACACAGCTGTGTGTGGG No data
973926420_973926422 -6 Left 973926420 4:55743088-55743110 CCCGAAGGCAGGGGAGAGCCAGC No data
Right 973926422 4:55743105-55743127 GCCAGCCACACAGCTGTGTGTGG No data
973926420_973926429 22 Left 973926420 4:55743088-55743110 CCCGAAGGCAGGGGAGAGCCAGC No data
Right 973926429 4:55743133-55743155 AGCTGCTGAGAGGAGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973926420 Original CRISPR GCTGGCTCTCCCCTGCCTTC GGG (reversed) Intergenic
No off target data available for this crispr