ID: 973926423

View in Genome Browser
Species Human (GRCh38)
Location 4:55743106-55743128
Sequence CCCACACACAGCTGTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973926423_973926426 -6 Left 973926423 4:55743106-55743128 CCAGCCACACAGCTGTGTGTGGG No data
Right 973926426 4:55743123-55743145 TGTGGGAGCCAGCTGCTGAGAGG No data
973926423_973926428 3 Left 973926423 4:55743106-55743128 CCAGCCACACAGCTGTGTGTGGG No data
Right 973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG No data
973926423_973926430 8 Left 973926423 4:55743106-55743128 CCAGCCACACAGCTGTGTGTGGG No data
Right 973926430 4:55743137-55743159 GCTGAGAGGAGCCGCAGGGCTGG No data
973926423_973926429 4 Left 973926423 4:55743106-55743128 CCAGCCACACAGCTGTGTGTGGG No data
Right 973926429 4:55743133-55743155 AGCTGCTGAGAGGAGCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973926423 Original CRISPR CCCACACACAGCTGTGTGGC TGG (reversed) Intergenic
No off target data available for this crispr