ID: 973926428

View in Genome Browser
Species Human (GRCh38)
Location 4:55743132-55743154
Sequence CAGCTGCTGAGAGGAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973926420_973926428 21 Left 973926420 4:55743088-55743110 CCCGAAGGCAGGGGAGAGCCAGC No data
Right 973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG No data
973926423_973926428 3 Left 973926423 4:55743106-55743128 CCAGCCACACAGCTGTGTGTGGG No data
Right 973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG No data
973926419_973926428 22 Left 973926419 4:55743087-55743109 CCCCGAAGGCAGGGGAGAGCCAG No data
Right 973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG No data
973926425_973926428 -1 Left 973926425 4:55743110-55743132 CCACACAGCTGTGTGTGGGAGCC No data
Right 973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG No data
973926421_973926428 20 Left 973926421 4:55743089-55743111 CCGAAGGCAGGGGAGAGCCAGCC No data
Right 973926428 4:55743132-55743154 CAGCTGCTGAGAGGAGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973926428 Original CRISPR CAGCTGCTGAGAGGAGCCGC AGG Intergenic
No off target data available for this crispr