ID: 973927023

View in Genome Browser
Species Human (GRCh38)
Location 4:55749036-55749058
Sequence TCTGTGGTCAGCAGTGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973927020_973927023 22 Left 973927020 4:55748991-55749013 CCAAGAATGAAGACAGAGAGTAG No data
Right 973927023 4:55749036-55749058 TCTGTGGTCAGCAGTGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973927023 Original CRISPR TCTGTGGTCAGCAGTGAATG AGG Intergenic
No off target data available for this crispr