ID: 973927024

View in Genome Browser
Species Human (GRCh38)
Location 4:55749039-55749061
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973927020_973927024 25 Left 973927020 4:55748991-55749013 CCAAGAATGAAGACAGAGAGTAG No data
Right 973927024 4:55749039-55749061 GTGGTCAGCAGTGAATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr