ID: 973928343

View in Genome Browser
Species Human (GRCh38)
Location 4:55763116-55763138
Sequence ATCTAACAGCAGCTACTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973928343_973928344 -1 Left 973928343 4:55763116-55763138 CCTTAGAGTAGCTGCTGTTAGAT No data
Right 973928344 4:55763138-55763160 TCACCATTACCCTCAAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973928343 Original CRISPR ATCTAACAGCAGCTACTCTA AGG (reversed) Intergenic
No off target data available for this crispr