ID: 973934399

View in Genome Browser
Species Human (GRCh38)
Location 4:55828409-55828431
Sequence TGCTATGGGAATCAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973934399_973934402 -10 Left 973934399 4:55828409-55828431 CCATCCTCTTGATTCCCATAGCA No data
Right 973934402 4:55828422-55828444 TCCCATAGCATTACACAGCTGGG No data
973934399_973934408 27 Left 973934399 4:55828409-55828431 CCATCCTCTTGATTCCCATAGCA No data
Right 973934408 4:55828459-55828481 CCCTTCTCAGACGTCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973934399 Original CRISPR TGCTATGGGAATCAAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr