ID: 973936576

View in Genome Browser
Species Human (GRCh38)
Location 4:55852711-55852733
Sequence GACCCTTTCCTGCTTGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973936576_973936578 13 Left 973936576 4:55852711-55852733 CCGGTGCCAAGCAGGAAAGGGTC No data
Right 973936578 4:55852747-55852769 AACCAGATCCTGCTCTTAAAAGG No data
973936576_973936579 14 Left 973936576 4:55852711-55852733 CCGGTGCCAAGCAGGAAAGGGTC No data
Right 973936579 4:55852748-55852770 ACCAGATCCTGCTCTTAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973936576 Original CRISPR GACCCTTTCCTGCTTGGCAC CGG (reversed) Intergenic
No off target data available for this crispr