ID: 973938282

View in Genome Browser
Species Human (GRCh38)
Location 4:55874531-55874553
Sequence CAGGAAAAACATCTTGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973938277_973938282 29 Left 973938277 4:55874479-55874501 CCCTTATGAAGGACTCACTTCTT 0: 1
1: 0
2: 2
3: 23
4: 215
Right 973938282 4:55874531-55874553 CAGGAAAAACATCTTGCATTTGG 0: 1
1: 0
2: 2
3: 18
4: 267
973938278_973938282 28 Left 973938278 4:55874480-55874502 CCTTATGAAGGACTCACTTCTTT 0: 1
1: 0
2: 0
3: 20
4: 224
Right 973938282 4:55874531-55874553 CAGGAAAAACATCTTGCATTTGG 0: 1
1: 0
2: 2
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973938282 Original CRISPR CAGGAAAAACATCTTGCATT TGG Intronic
903440425 1:23384015-23384037 GAGGAAAAACATTCTGCACTTGG - Intronic
903601997 1:24549211-24549233 CTGAAAAAATATCTGGCATTTGG - Intergenic
903649073 1:24912106-24912128 CAGAAAAAGCCTCTTTCATTCGG + Intronic
905788988 1:40780296-40780318 CAGGTAAAACATCCTGCATAAGG + Intergenic
910706759 1:90138910-90138932 CAGGCAAAACAGCTTGAATCAGG + Intergenic
911014548 1:93318329-93318351 AAGGAAAAAGATTTTGCAGTAGG + Intergenic
916893784 1:169139871-169139893 CAGGGATCACATATTGCATTTGG - Intronic
917110190 1:171539619-171539641 CAGGACAAATATCTTACATGAGG - Intronic
920573680 1:207039044-207039066 CAAGAAAATGATCTTGAATTTGG - Intronic
921717951 1:218437616-218437638 CTGGAGAAAAATCTTTCATTAGG + Intronic
924476821 1:244389652-244389674 AAGGAAAAAAACCTTACATTTGG + Intronic
924555358 1:245114068-245114090 CAGAAACAACATCCTGCTTTTGG - Intronic
1063280398 10:4623266-4623288 AAAAAAAAACAACTTGCATTTGG - Intergenic
1064468181 10:15606749-15606771 CACAAAAAACATCATGAATTTGG + Intronic
1065666799 10:28071838-28071860 CAGGAATAAGAACTAGCATTTGG + Intronic
1066332883 10:34444036-34444058 CAAGAAAAACATCTTTTAATTGG - Intronic
1069234514 10:66053843-66053865 AAGGAATAAGATCTGGCATTTGG - Intronic
1069254742 10:66318542-66318564 GAGGAAAAACATGTGGCATATGG - Intronic
1071849705 10:89556559-89556581 CAGGAAAAAGTTCCTGCCTTGGG - Intronic
1072328449 10:94321975-94321997 CTGGAGAAACATCATGCACTTGG - Exonic
1073723057 10:106196766-106196788 CAGGAAAAAAAGTCTGCATTGGG - Intergenic
1074641954 10:115395103-115395125 AAGCAAAAACATGTGGCATTTGG + Intronic
1075218731 10:120564258-120564280 CAAGAAAAATATCTTACTTTTGG - Intronic
1076222801 10:128748094-128748116 CAGGAAAAAGGAGTTGCATTTGG - Intergenic
1077395934 11:2321240-2321262 GAGGAAACACAGCCTGCATTTGG - Intergenic
1077794149 11:5473216-5473238 CAGAAAAAAAATCTTGAATAAGG + Intronic
1078344334 11:10531446-10531468 CATGAAAAACATCTTGCTCTTGG + Intronic
1079120935 11:17684352-17684374 CAGGCAAACCATCTTGGTTTGGG + Intergenic
1080678401 11:34449481-34449503 AAGGAAAAACATCCAGCAGTAGG + Intronic
1084785785 11:71440933-71440955 CAGGAAAAACTTCTGGCTTGGGG - Intronic
1085586947 11:77717452-77717474 CAGGAGCAACATCTAGCCTTAGG - Intronic
1086682536 11:89690546-89690568 AAGACAAGACATCTTGCATTTGG - Intergenic
1087375415 11:97333747-97333769 CAGGTAAAACATTTTGAAATGGG - Intergenic
1087596820 11:100264464-100264486 CAGGGAGAACATGTGGCATTTGG + Intronic
1088076935 11:105861243-105861265 GAGGAGAAACAACTTGAATTGGG - Intronic
1088441011 11:109870273-109870295 ATGGAAAAACATCATGTATTTGG + Intergenic
1092182834 12:6457817-6457839 CAGGAAATCATTCTTGCATTTGG - Intronic
1092888740 12:12949417-12949439 CAGGAGAAAAATCATGCAGTAGG - Intronic
1092908037 12:13119947-13119969 CAGGACAAACATCTTGGAGGAGG + Intronic
1093067765 12:14676272-14676294 CAGGAAAAAGAGCCTCCATTTGG - Intronic
1093780801 12:23135245-23135267 GAGGAAAAACAACCAGCATTAGG + Intergenic
1094341638 12:29418604-29418626 CTGGAAAAACGTATTGAATTTGG - Intronic
1095717864 12:45367822-45367844 TAGAAAAAAAATCTTTCATTAGG - Intronic
1095860029 12:46906401-46906423 AAGGAATAAGATCTTGTATTTGG - Intergenic
1097864159 12:64545145-64545167 CAGGAAAAAAAGCTTGGATTGGG + Intergenic
1101044220 12:100787869-100787891 GAGGAAAAAAAGCTTGGATTTGG + Intronic
1101512025 12:105402003-105402025 CAGGACAAACATCTTGTCATGGG - Intergenic
1101742607 12:107512517-107512539 CAGGGAAAACATCTCACATATGG + Intronic
1103246139 12:119459151-119459173 CAGAAAAAAAATCTTCCAGTTGG - Intronic
1105203935 13:18203484-18203506 CAGTAAAAACATAGTACATTGGG + Intergenic
1105872746 13:24521905-24521927 CAGGCAAAACATGTTGAATTCGG - Intergenic
1106571385 13:30931378-30931400 CAGGAAATACATTTTGGAGTTGG - Intergenic
1106620859 13:31369173-31369195 CAGAAAAATCATTTTGCATTTGG - Intergenic
1106829270 13:33561375-33561397 AGGGAAAAACATCTTCAATTTGG - Intergenic
1107680282 13:42841314-42841336 CAGGTAAAAGATGTTGCAGTAGG - Intergenic
1109600871 13:64626945-64626967 CAGCAAAAACATCCAGCAGTGGG + Intergenic
1109708443 13:66130509-66130531 CAAGAAAATCTTCATGCATTTGG + Intergenic
1110268018 13:73560511-73560533 AAGGAAAAACATCTTTCCATTGG + Intergenic
1110313878 13:74082609-74082631 CACTAAAAACAACTTGTATTTGG - Intronic
1111122174 13:83867308-83867330 CAGGAAAAACAACAAGCATGTGG + Intergenic
1111653504 13:91123725-91123747 CAGGGAAAACATGATGCACTTGG - Intergenic
1111886812 13:94031660-94031682 CAAGAAAACCATTTTGCATTTGG - Intronic
1112700400 13:102001379-102001401 CAGGAAAACCAGCAAGCATTAGG + Intronic
1113045509 13:106150696-106150718 CAAGCAAAACAGCTTGCAGTTGG + Intergenic
1113430530 13:110246571-110246593 GAGGAAATACACCTTGCATCTGG + Intronic
1115326026 14:32139321-32139343 CAGTGAAAATATCTTGTATTGGG + Intronic
1116369256 14:44109021-44109043 CAGGAAAAAAATTATGCATGTGG - Intergenic
1116995912 14:51323861-51323883 CGGAAAAAACACCTTTCATTTGG + Intergenic
1121128308 14:91422629-91422651 CAGGAAAAACATAAAGGATTTGG + Intergenic
1125107034 15:35984080-35984102 CAGTAAAAATATTTTGGATTTGG - Intergenic
1126706443 15:51410288-51410310 CAGAAAAGACATTTTGCTTTTGG + Intergenic
1127405228 15:58637429-58637451 CAGGAAAATCATTTTGCTTCTGG - Intronic
1128192182 15:65712547-65712569 TAGGAAAAACATACTACATTGGG - Intronic
1129482518 15:75839178-75839200 CAAGAAAAAGATGTTGAATTTGG - Intergenic
1129915748 15:79268935-79268957 CTGGAAAGACATTTTGTATTTGG - Intergenic
1130444829 15:83991014-83991036 TTGGTAAAACATATTGCATTTGG - Intronic
1131283809 15:91041377-91041399 CTGGAAAAACATCCTGGAATAGG + Intergenic
1133130023 16:3671266-3671288 AAGGAAATACTACTTGCATTAGG + Intronic
1134139877 16:11709167-11709189 TAGAAAAAAAATCTGGCATTTGG + Intronic
1135898449 16:26432150-26432172 CTGGAACAAACTCTTGCATTAGG + Intergenic
1137476604 16:48814838-48814860 CAGGGAAATCATTTGGCATTTGG - Intergenic
1137477940 16:48827009-48827031 CTGGAAAAACATCCTGCATTTGG + Intergenic
1137582988 16:49645533-49645555 CCTGAAAAGCATCTAGCATTGGG - Intronic
1138962835 16:62047914-62047936 CAGGAAAAGCTTTTTGCATCTGG + Intergenic
1139035917 16:62946436-62946458 CAGGAGAATCTTCTGGCATTTGG - Intergenic
1139041057 16:62999482-62999504 TATGAAATACATCTTGCATTTGG - Intergenic
1139266563 16:65645299-65645321 CTGGGAAAACATGTTGCATGGGG + Intergenic
1140665402 16:77222871-77222893 CAGGAAACACATCTTCCTATGGG + Intergenic
1141886086 16:86893370-86893392 CTGGAAGCACACCTTGCATTTGG - Intergenic
1144229650 17:13188860-13188882 CATGAAGAACATATTGTATTTGG - Intergenic
1146905397 17:36614658-36614680 GAGGACAAGCATCTTGCCTTGGG - Intergenic
1147036230 17:37683410-37683432 CAGGAAAGAAATCTTTCTTTGGG + Intergenic
1147219021 17:38917572-38917594 CAGGACAAAGATCTTTCCTTGGG - Intronic
1148576788 17:48718162-48718184 CAGGAACATCATTTTGCATCAGG + Intergenic
1151277477 17:73046561-73046583 CAGGAAAAACATGTAGTATTAGG - Intronic
1151505278 17:74523179-74523201 CAGGAAACACAACCTGTATTTGG - Intronic
1153985418 18:10346727-10346749 CAAGAAAAATATCTTGAACTGGG - Intergenic
1155636376 18:27960370-27960392 CAGGAAGAACATCTTGTAGATGG + Intronic
1156869584 18:41930123-41930145 AAGGAAAAACATTCTGGATTGGG + Intergenic
1158863338 18:61614568-61614590 CAGGAAAAGCATGGTGTATTAGG - Intergenic
1160111545 18:76037001-76037023 AAGGAAAAACCTCTTGCCTCAGG + Intergenic
1161435605 19:4260956-4260978 GAGGAAGAGCGTCTTGCATTGGG + Intronic
1163993114 19:21017900-21017922 CTGTAAAAGCATCTGGCATTGGG - Intergenic
1167188041 19:47961612-47961634 CTGGAAGAGCATCTTGCAGTGGG - Intergenic
1167926091 19:52821827-52821849 CGGGAGATACAGCTTGCATTGGG + Intronic
1168523962 19:57074111-57074133 AAAAAAAAACAACTTGCATTTGG + Intergenic
926369864 2:12168882-12168904 CAGGAAAAACAACTAGCAAGGGG + Intergenic
932730908 2:74221482-74221504 CAGGAAAAAGATCTTCCAGTTGG - Exonic
933185965 2:79279570-79279592 TAGGAAAAAGATCTTCCCTTTGG + Intronic
935038276 2:99400644-99400666 CAGGAAAAAAATCTTCAAGTGGG + Exonic
936631555 2:114208496-114208518 AAGAAAATACATTTTGCATTAGG + Intergenic
939070826 2:137539871-137539893 CAAGAAATACATCATGAATTGGG - Intronic
939914125 2:148019876-148019898 CAGCAAAAACAGCTGGCATTTGG + Intronic
942853759 2:180522089-180522111 AAGGGAAAACATCTTTCAGTGGG - Intergenic
943849272 2:192695752-192695774 CAAGAAAAGCAGATTGCATTGGG - Intergenic
944521694 2:200576481-200576503 CAGGAGAATCACCTTGAATTCGG + Intronic
945146672 2:206745654-206745676 CAGGAGAAACTTGTTGCACTTGG - Exonic
946166283 2:217866057-217866079 CAGGAGAACCCTCTTGCCTTTGG - Intronic
946477665 2:220024288-220024310 CAGAATAAAAATCTTGTATTTGG + Intergenic
946760774 2:222991024-222991046 CAGGAAAAAAATATTACCTTAGG + Intergenic
947025764 2:225736086-225736108 AAAGAAAAAAATCTTGCAGTTGG + Intergenic
947269148 2:228314186-228314208 CAGTTAAAACATTTTGCATTTGG - Intergenic
947323036 2:228943966-228943988 CAGAACAAACATCTAGCATTGGG + Intronic
947456424 2:230258213-230258235 CAGAAAAGACATCTTGGATGGGG - Intronic
1169778631 20:9284208-9284230 CAGGAAAAGCATCTTAGATATGG + Intronic
1170132664 20:13038297-13038319 CAGCAAAGACATCTGGGATTGGG + Intronic
1170807976 20:19650309-19650331 CAAGAAATGCATCTTGCACTAGG - Intronic
1175238894 20:57532028-57532050 CAGGAAAAACAGCTGGGAGTGGG + Intergenic
1176714035 21:10334601-10334623 CAGTAAAAACATAGTACATTGGG - Intergenic
1176892421 21:14333856-14333878 CAAAAAAAATACCTTGCATTTGG - Intergenic
1177784013 21:25650234-25650256 TAGGAAAATCATCTTTGATTTGG - Intronic
1178029053 21:28504239-28504261 CAGGGAGTACATCTTGCATAAGG - Intergenic
1178112455 21:29382374-29382396 CACGAAGAACTTCTTGCATTTGG - Intronic
1178292841 21:31384301-31384323 CAGGGAAAACATTTTTAATTTGG - Intronic
1181070687 22:20335128-20335150 CAGTAAAAACATAGTACATTGGG + Intergenic
950102480 3:10366418-10366440 CAGGAAAACCATCCTGCAGGGGG + Intronic
950215757 3:11157386-11157408 CAGATAAAACATCTTGGATCAGG - Intronic
950946339 3:16951888-16951910 CAAAAAAAAGATCTTGTATTAGG - Intronic
953622195 3:44543039-44543061 CAAGAAAAAAATCATGCTTTTGG + Intergenic
954095518 3:48323749-48323771 GGGGAAAAACACCTTACATTTGG - Intronic
955311496 3:57892348-57892370 CAGAAAGCACATTTTGCATTAGG - Intronic
956046906 3:65205530-65205552 CAGAAAAATCATGTGGCATTGGG - Intergenic
956704704 3:71989309-71989331 CAGGAGAAGCATCATGCTTTGGG + Intergenic
959461932 3:106637660-106637682 CAGGAAGAACATACTTCATTAGG - Intergenic
959822511 3:110753203-110753225 CAGGAAAAATAATTTGCAATTGG + Intergenic
961359898 3:126360495-126360517 CAGGAAAAACATGCTGCAGGAGG + Intergenic
962003329 3:131323412-131323434 CAGGAAAAACAGCTGAGATTGGG - Intronic
964152728 3:153547478-153547500 CAGGACAAAAATCTTGCCTTTGG + Intergenic
964590462 3:158357782-158357804 TAGGAAAAACACCTTGATTTGGG + Intronic
964874999 3:161357215-161357237 CAGTGAAAACATGTTGCTTTAGG + Intronic
965202552 3:165677881-165677903 AAGGAAAAGCATCCTGTATTGGG + Intergenic
969286371 4:6204927-6204949 CAGCTAAAATATCTTGCTTTTGG + Intergenic
970445151 4:16117211-16117233 CAGGTTAAACATCTTGAACTAGG - Intergenic
971549495 4:27932544-27932566 AAGGAAAAACCTCATGCATGAGG - Intergenic
971931912 4:33095564-33095586 CAGCAAAAGCATCATTCATTTGG - Intergenic
972047758 4:34690286-34690308 CGGGAAAATCAACTTGAATTTGG + Intergenic
972309140 4:37863805-37863827 CAGGAAAAAGATCAGGGATTAGG + Intergenic
972775136 4:42233272-42233294 CTGCAAAAACATCATGCAATGGG - Intergenic
973053691 4:45628398-45628420 AAGGAATAAGATCTTGTATTAGG - Intergenic
973938282 4:55874531-55874553 CAGGAAAAACATCTTGCATTTGG + Intronic
974038064 4:56834482-56834504 AAGGAAAACCATATTGAATTAGG - Intergenic
975306801 4:72858841-72858863 GGGGAGACACATCTTGCATTGGG - Intergenic
976288348 4:83391855-83391877 AAGGAAAAACGTTTAGCATTTGG + Intergenic
978533948 4:109741316-109741338 CAGGAAGAACATGCTGAATTGGG - Intronic
978563265 4:110055574-110055596 CAGGAAAAGCAACAAGCATTTGG + Intronic
979008415 4:115335113-115335135 CAGGAATGATTTCTTGCATTAGG + Intergenic
979411608 4:120385550-120385572 AAGGAAAAACTCCTTTCATTTGG + Intergenic
981281287 4:142962563-142962585 CAGGAAAATAAACTTTCATTAGG + Intergenic
982320140 4:154068667-154068689 CAGGGCAAACATCTAGCAGTTGG + Intergenic
983095896 4:163561840-163561862 CAGTAAAAACATCTATCTTTTGG + Intronic
985047543 4:185955522-185955544 CATGAGAAACATATTGCATTAGG - Intronic
985183352 4:187289562-187289584 CAGGAAAAATATTTTTCACTAGG + Intergenic
986398697 5:7357568-7357590 CAGTAGAAAAATCTTACATTGGG + Intergenic
988026264 5:25694386-25694408 CAGGAAGTACATTTTTCATTTGG + Intergenic
988514424 5:31892352-31892374 CAGTAAATACATCTTGCTCTTGG - Intronic
990834164 5:59996600-59996622 GAGGAAAAACATTTGGCATAAGG - Intronic
991470872 5:66967699-66967721 AAAGAAAAACATCTTCCATCAGG + Intronic
991483180 5:67105658-67105680 CAGGAAAATGATCATGCACTTGG + Intronic
992430469 5:76705842-76705864 CAGGAATTATATCTTCCATTGGG + Intronic
993216538 5:85030551-85030573 CAGGAAATACATTTGGCATCTGG - Intergenic
993687459 5:90957142-90957164 CAGGAAAAAAGTCTTTCCTTAGG + Intronic
994209880 5:97075316-97075338 CATGAAATAGATCTGGCATTTGG - Intergenic
994341287 5:98631601-98631623 AAGGAAGAACATCTAGAATTTGG + Intergenic
996310675 5:122100676-122100698 AAGGAAGAACATTTTGCTTTTGG - Intergenic
997630274 5:135362634-135362656 TTGGAAAAACATCTTGTAATGGG - Intronic
998638595 5:143984599-143984621 CAGGAAAATCACATTGGATTTGG - Intergenic
1003002833 6:2351874-2351896 CAAGAAAAATAACTTGCTTTTGG + Intergenic
1003297833 6:4849249-4849271 GAGGAAAAACATCTTGAAGGGGG + Intronic
1005352155 6:24947318-24947340 CAGGAAGAACTACATGCATTTGG + Intronic
1006967842 6:38007695-38007717 CAGGAATCACATCTTGCATCAGG - Intronic
1008131145 6:47721155-47721177 CAAGAATAATAGCTTGCATTGGG - Intronic
1011044157 6:83063977-83063999 CAAGAAAAACATCCAGCAATAGG + Intronic
1011058865 6:83239085-83239107 AAGAAAAAACATTTTGAATTAGG - Intronic
1011521020 6:88206508-88206530 CAGGACATACATCTTTCTTTAGG - Intergenic
1012862665 6:104579443-104579465 CAGGAATATCATGTTGCATAAGG - Intergenic
1014348093 6:120301235-120301257 CAAGAAAAATATTTTGCATTTGG + Intergenic
1016021206 6:139237855-139237877 CAGGAAGAAGGACTTGCATTTGG + Intergenic
1016155552 6:140802979-140803001 CAGTAAAAACATCTTTTATAAGG - Intergenic
1016315891 6:142786444-142786466 CAGAAAAACCATCTTGTATGTGG - Intronic
1016317413 6:142805871-142805893 CAGGCAAAACATCTGACACTTGG - Intronic
1016696591 6:147003309-147003331 CAGCTAAAACATTTTGCAGTAGG + Intergenic
1016905832 6:149149991-149150013 CAGGAAGAACAAGTTCCATTAGG + Intergenic
1017679426 6:156848568-156848590 CAGGAAAAGGATCTTCCATGTGG + Intronic
1018285638 6:162234894-162234916 CTGGAAAAACAACTGGCAGTGGG + Intronic
1018313281 6:162532106-162532128 CAGGGGAAACTTCTTCCATTTGG - Intronic
1019024450 6:168947070-168947092 AAGAAAAAACATCTTGAAATTGG - Intergenic
1019882682 7:3876677-3876699 CTCCAAAAACATCTTTCATTTGG - Intronic
1021930166 7:25572713-25572735 ATGAAAAAACATCATGCATTTGG + Intergenic
1022829907 7:34055513-34055535 CAAGAAAAACATCTTTCAGACGG - Intronic
1023703980 7:42919928-42919950 TAGGAAAAACATATGGCCTTTGG + Intronic
1023704932 7:42931764-42931786 CAGGAAAAAAATCCTGAGTTCGG + Intronic
1024749160 7:52444420-52444442 AAGTAAAAACACCTTACATTTGG - Intergenic
1025175515 7:56799295-56799317 CAGGAAATAGGTATTGCATTTGG - Intergenic
1025696283 7:63777125-63777147 CAGGAAATAGGTATTGCATTTGG + Intergenic
1025913171 7:65844032-65844054 CAGGAAATAGGTATTGCATTTGG + Intergenic
1025924961 7:65950931-65950953 AAAGGAAAACATCTTGCATCTGG - Intronic
1025976454 7:66374420-66374442 CAGGAAATAGGTATTGCATTTGG - Intronic
1027807806 7:82851817-82851839 CAGCAAACACATCTTGCAAGTGG + Intronic
1027930985 7:84534708-84534730 CAGAAAATACATCCTGTATTAGG - Intergenic
1028496288 7:91464452-91464474 CACTAAAAGCATCTGGCATTAGG - Intergenic
1028651427 7:93154374-93154396 CAGGAAATAGATATTGTATTTGG - Intergenic
1031943028 7:127809390-127809412 CAGGAAAAGCAGTTTGCATCAGG - Intronic
1032158779 7:129493656-129493678 CAGGACAAAGATCTTCCATGTGG + Intergenic
1032224264 7:130018129-130018151 AATGAAAATCATCTTGCTTTTGG + Intergenic
1032583062 7:133121180-133121202 AAGAAAAAACATTATGCATTTGG + Intergenic
1033403438 7:141049223-141049245 CAGGAATTTCATCTGGCATTTGG + Intergenic
1034917153 7:155049905-155049927 CAGGGAAAACATCAAGCACTTGG + Intergenic
1036455906 8:8907110-8907132 CAGGCAAAACAGTTTGCATTAGG + Intergenic
1036520638 8:9488538-9488560 AAGGAAAGGCATTTTGCATTTGG + Intergenic
1036945543 8:13091318-13091340 CTGGAAAAGCTTCTTGCACTCGG + Exonic
1038938575 8:32279235-32279257 CATGAAAAGCAGCTTGCACTCGG - Intronic
1039410423 8:37350240-37350262 TAGAAAAAAAGTCTTGCATTTGG - Intergenic
1039803185 8:40977387-40977409 CAGGAAATACACCTGGAATTTGG - Intergenic
1040611600 8:48989882-48989904 GAGGAAAGACCTCTTGCCTTTGG - Intergenic
1040717098 8:50269687-50269709 CACGTACAACAGCTTGCATTTGG + Intronic
1040905209 8:52462386-52462408 GAGCAAAAAAATCTTGCTTTTGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1042031001 8:64475268-64475290 GAGGAAAAAGAACTAGCATTAGG - Intergenic
1042267910 8:66927219-66927241 CAGGAGAAACGGCTTCCATTTGG - Intergenic
1043113045 8:76212470-76212492 GAGGAAAAACATCATAAATTTGG - Intergenic
1043362640 8:79493227-79493249 AAGGAATAAGATCTAGCATTTGG - Intergenic
1044023917 8:87144244-87144266 AAGAGAAAACATCTTTCATTTGG + Intronic
1045666648 8:104494649-104494671 CAGGAAAAACATCTTCAAGCTGG - Intronic
1045742893 8:105383078-105383100 CAGGAAAAATATCATGCCTGGGG + Intronic
1047022777 8:120793997-120794019 AAGGAAAAAAATCCTGCAATTGG + Intronic
1047297060 8:123580328-123580350 CAGCAATAACATCTTTCCTTAGG + Intergenic
1047468904 8:125147797-125147819 CAGTAAAAACCTCTTGACTTTGG - Intronic
1047733241 8:127743896-127743918 AAGGACAAAAATGTTGCATTAGG + Intergenic
1048098098 8:131315974-131315996 AAGGAAGAACATCTAGCATCAGG - Intergenic
1048836386 8:138522712-138522734 CAGTTAAAACATCTGGCAATGGG + Intergenic
1050221444 9:3395199-3395221 CAGAAAAAATAACTTGCTTTAGG + Intronic
1051020564 9:12537408-12537430 CAGGAAAAACATGTTCAAATTGG - Intergenic
1052060071 9:23949099-23949121 CAGGAAAAATCTCTTTAATTTGG + Intergenic
1052069441 9:24064213-24064235 CAGGAAAAACAACTTTAATCAGG + Intergenic
1052287643 9:26804835-26804857 CAGGCAAAAAATCTTGCTGTTGG - Intergenic
1052543450 9:29841757-29841779 CAGGAAAAACTGCTTGAATGAGG - Intergenic
1055353801 9:75417047-75417069 TAGGAAAAACATCTTAGAGTAGG - Intergenic
1056076290 9:83044333-83044355 CAGAAGATACATCTTGGATTTGG - Intronic
1057719736 9:97522379-97522401 CAGGTAAAATATATTGGATTAGG + Intronic
1058293709 9:103278202-103278224 CATGAAAAACATCTTGAATTTGG + Intergenic
1059465781 9:114467911-114467933 CAGGAAAGACACATTTCATTAGG + Intronic
1059643501 9:116240420-116240442 CAGGAAAAAAATCTAGCCCTCGG - Intronic
1061462816 9:130753882-130753904 CAGCAAACACATCTTCCCTTAGG - Intronic
1061673128 9:132200505-132200527 CGGGAAAAACATCATGGGTTGGG + Intronic
1062199833 9:135296687-135296709 CAGGACACACACCTTGCTTTGGG - Intergenic
1186032330 X:5381722-5381744 GAAGAAAAACAACTTTCATTAGG - Intergenic
1186279449 X:7976819-7976841 GAGGAAACACATTTTTCATTTGG + Intergenic
1186900789 X:14053319-14053341 AAGGAAAAAAATATGGCATTTGG - Intergenic
1187533281 X:20115903-20115925 CAGGAAAAACAGCATGAAATCGG + Intronic
1187667832 X:21633890-21633912 CAGCAAAGTCATCTTGGATTTGG - Intronic
1188051085 X:25487259-25487281 CAGGAAAAATCTCTTGAATCTGG + Intergenic
1188135427 X:26488694-26488716 GAGAAAAAATATCTTGTATTTGG - Intergenic
1188409804 X:29857954-29857976 TAGGAAAGACATCTTTCACTTGG + Intronic
1188777546 X:34239498-34239520 AAGTCAAAACAACTTGCATTTGG - Intergenic
1192584427 X:72308045-72308067 CAAGAATAACGTTTTGCATTTGG + Intergenic
1194224219 X:91235407-91235429 CAGGAAAAACAGCTTTCGATAGG - Intergenic
1194565043 X:95475806-95475828 CTGGAAAAATATCTGGCATATGG - Intergenic
1194630907 X:96282306-96282328 CCCTAAAAACATCTTGCCTTTGG + Intergenic
1194670002 X:96720026-96720048 CAGGTATAACCTCTTGGATTCGG + Intronic
1195929306 X:110058028-110058050 TAGGAAAAACTTCTTGAAATTGG - Intronic
1196327619 X:114426123-114426145 CAGGCAAAACATCTTGATGTGGG - Intergenic
1196356544 X:114801097-114801119 GAGGAAAAAAATCCTGAATTAGG - Intronic
1197027042 X:121764915-121764937 TAGGAAAAACTTCTTGTAATTGG + Intergenic
1197262056 X:124330563-124330585 CAGGAAAAACTTCTTGGAAGAGG + Intronic
1199732626 X:150651585-150651607 CAAGAGAAACACCATGCATTTGG + Intronic
1199800304 X:151244457-151244479 AAGGAATAACATCTAGTATTTGG - Intergenic
1201864111 Y:18630998-18631020 CAGGAAAATAATCCTCCATTTGG + Intergenic
1201869211 Y:18689380-18689402 CAGGAAAATAATCCTCCATTTGG - Intergenic