ID: 973938410

View in Genome Browser
Species Human (GRCh38)
Location 4:55876523-55876545
Sequence CTGAAAACTCAGACTAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 440}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973938410_973938414 15 Left 973938410 4:55876523-55876545 CCAAGCTTAGTCTGAGTTTTCAG 0: 1
1: 0
2: 1
3: 17
4: 440
Right 973938414 4:55876561-55876583 AGAATTACAGAAAGGGATTATGG 0: 1
1: 0
2: 2
3: 41
4: 369
973938410_973938412 7 Left 973938410 4:55876523-55876545 CCAAGCTTAGTCTGAGTTTTCAG 0: 1
1: 0
2: 1
3: 17
4: 440
Right 973938412 4:55876553-55876575 TGGCTGTCAGAATTACAGAAAGG 0: 1
1: 0
2: 2
3: 16
4: 226
973938410_973938413 8 Left 973938410 4:55876523-55876545 CCAAGCTTAGTCTGAGTTTTCAG 0: 1
1: 0
2: 1
3: 17
4: 440
Right 973938413 4:55876554-55876576 GGCTGTCAGAATTACAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973938410 Original CRISPR CTGAAAACTCAGACTAAGCT TGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901227667 1:7623657-7623679 CTGAAAATACAGAATTAGCTGGG - Intronic
902198059 1:14812850-14812872 GTGAAAACTCTGACCAAGCGTGG + Intronic
902972276 1:20062496-20062518 CTGAAAACTCAGAGCAGGCTGGG + Intronic
904447132 1:30583435-30583457 CTGAAAACTCTCAATAAACTAGG - Intergenic
905768993 1:40625371-40625393 CTGGGAGCTCAGACTTAGCTGGG - Exonic
906881739 1:49598782-49598804 CTAAAAACTCTCAATAAGCTGGG - Intronic
907458569 1:54591877-54591899 TTGGAACCTCAGAATAAGCTTGG - Intronic
907668674 1:56455136-56455158 CTAAAAACACAAAATAAGCTGGG + Intergenic
907735627 1:57109005-57109027 CCAAAAACTCAGAGTTAGCTAGG - Intronic
908091008 1:60685753-60685775 CTGAAACCACAGCCTGAGCTTGG - Intergenic
908178053 1:61575559-61575581 CTGAAAACTCTCAATAAACTAGG - Intergenic
910542174 1:88372301-88372323 CTGCAAACTCAGACTATGGAGGG + Intergenic
910635302 1:89401362-89401384 CTGAAAACTCTCAATAAACTAGG - Intergenic
911170118 1:94762426-94762448 CTAAAAACTCTGAATAAACTAGG + Intergenic
911724667 1:101230524-101230546 CTGAAAACTCTCAATAAACTAGG + Intergenic
911991046 1:104697077-104697099 CTAAAAACTCTCAATAAGCTAGG + Intergenic
912171180 1:107101305-107101327 CTCAGAGCTCATACTAAGCTTGG - Intergenic
912226118 1:107736167-107736189 CTGAAAACTCTCAATAAACTAGG + Intronic
912965668 1:114235145-114235167 CTGAAAACTCAGGCTGACTTAGG + Intergenic
913000881 1:114579569-114579591 CTTAAAACTCAGCCAAGGCTGGG + Intronic
913020687 1:114786506-114786528 CTAAAAACTCTCAATAAGCTAGG - Intergenic
913156690 1:116106650-116106672 CTGAAAACACAAAATTAGCTGGG - Intergenic
913175774 1:116271837-116271859 CTGACAACTCAGATTGAGGTTGG + Intergenic
913427939 1:118755672-118755694 CTGAAAACTAAGAAAATGCTTGG + Intergenic
914459059 1:147865558-147865580 CTAAAAACTCTGAATAAACTAGG + Intergenic
916924298 1:169501644-169501666 CTAAAAACTCTGAATAAACTAGG + Intergenic
917579413 1:176359815-176359837 CTGAAAACTCTCAATAAGCTAGG + Intergenic
917622101 1:176807045-176807067 GAGAAAACTCAGTCTAAGATAGG + Intronic
917801772 1:178577917-178577939 CAGAAGTCTCAGAGTAAGCTCGG - Intergenic
918708134 1:187694143-187694165 CTGAACATTGAGACAAAGCTAGG + Intergenic
918945507 1:191059470-191059492 CTAAAAACTCTGAATAAACTAGG - Intergenic
920109867 1:203580233-203580255 CTAAAAACTCAAAATTAGCTGGG - Intergenic
920512352 1:206560459-206560481 CTGAAAAGAGAGACCAAGCTAGG - Intronic
922031249 1:221801720-221801742 CGGAAAACTGAGACTAAGGTAGG - Intergenic
922129581 1:222763942-222763964 CTAAAAACTCTGAATAAACTAGG + Intergenic
922666886 1:227477860-227477882 CTAAAAACTCTGAATAAACTAGG + Intergenic
923204069 1:231741140-231741162 CTGACAACTCGGGCTAGGCTGGG + Intronic
923225246 1:231933247-231933269 CTGTGAACTCAGGCTAACCTAGG - Intronic
923682551 1:236129719-236129741 CTTAAAACTCATACTATGCCAGG + Intergenic
923911465 1:238449885-238449907 CTTAAATCTCAAACTAACCTTGG - Intergenic
924868237 1:248009975-248009997 CTAAAAACTCTCAATAAGCTAGG + Intronic
1063812119 10:9723152-9723174 CTGTAAACTCAGGCCAAGGTGGG - Intergenic
1064007528 10:11710326-11710348 CTAAAAATTCAGAATTAGCTGGG - Intergenic
1064545436 10:16445609-16445631 CTGAAATCAAAGACTGAGCTTGG - Intronic
1068516657 10:58033526-58033548 CTGAAAACTCTCAATAAACTAGG - Intergenic
1070339896 10:75488365-75488387 CTGAAAGCTCAGAGTGTGCTTGG + Intronic
1071070640 10:81689402-81689424 ATAAAAACTCTGAGTAAGCTAGG - Intergenic
1072008577 10:91283347-91283369 CTGAAAAATCAGTCTCAGTTTGG - Exonic
1072219004 10:93311752-93311774 CTTACAAGTCAGACAAAGCTGGG + Intronic
1072407128 10:95165774-95165796 CTAAAAACTCTCAATAAGCTGGG + Intergenic
1072480293 10:95804860-95804882 CTGAAAACTCTCAATAAACTAGG - Intronic
1076060061 10:127407148-127407170 AGGAGAACTCAGAATAAGCTGGG + Intronic
1077674511 11:4184399-4184421 CTGAAAACTAAGACTGAGAGAGG - Intergenic
1078167085 11:8896945-8896967 TTGAAAACTGAGACTGGGCTCGG + Intronic
1078392523 11:10948447-10948469 CTAAAAACTCACAATAAACTAGG - Intergenic
1078611847 11:12827343-12827365 TTGAAAACTCAGAAAATGCTGGG - Intronic
1078780345 11:14432881-14432903 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1079781435 11:24610782-24610804 CTGAAAACACAAAATGAGCTGGG + Intronic
1080196066 11:29610578-29610600 CTGGAAAATCAGACTCAGATAGG + Intergenic
1080736996 11:35025932-35025954 CTGAAAACTCTCAATAAACTAGG + Intergenic
1080761692 11:35256444-35256466 CTGGAAACTCACTCTATGCTAGG + Exonic
1081082695 11:38762847-38762869 CTAAAAACTCTGAATAAACTAGG - Intergenic
1081171705 11:39877545-39877567 CTAAAAACTCCCAATAAGCTAGG + Intergenic
1081338545 11:41899038-41899060 CTGAAAAATGAGCCTTAGCTTGG + Intergenic
1082110261 11:48266326-48266348 CTGAGAAATCAGACACAGCTAGG - Intergenic
1082707387 11:56509246-56509268 CTGAAAACTCTCAATAAACTAGG + Intergenic
1083073125 11:60007806-60007828 CTAAAAACTCTCAGTAAGCTAGG - Intergenic
1084983565 11:72847519-72847541 ATGAAAACTAAGATTAAGTTTGG + Intronic
1085672666 11:78483199-78483221 CTGAAAACTCTCAATAAACTAGG + Intronic
1086797860 11:91131435-91131457 CTGAAAACTCAGCGTTTGCTTGG - Intergenic
1087569473 11:99906317-99906339 CTAAAAACTCTCAATAAGCTAGG - Intronic
1087625410 11:100589957-100589979 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1087653675 11:100898022-100898044 CTGAAAACTCTCAATAAACTAGG - Intronic
1087668175 11:101074286-101074308 CTAAAAACTCTCAATAAGCTAGG + Intronic
1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG + Intergenic
1088004304 11:104922366-104922388 CTAAAAACTCTGAATAAACTAGG - Intergenic
1088039171 11:105355840-105355862 CAGAAAACTCAGATTAAGAAGGG - Intergenic
1088151797 11:106754537-106754559 CTAAAAACTCACAATAAACTAGG - Intronic
1088313174 11:108481879-108481901 CTGAAAATTCTGACCAACCTAGG - Intronic
1088672735 11:112159189-112159211 CTGAAAACACAAAATTAGCTGGG + Intronic
1090812361 11:130256707-130256729 CTAAAAACTCTGAATAAACTAGG + Intronic
1091364686 11:135007751-135007773 AAGAAAACCCAGACCAAGCTTGG - Intergenic
1092546396 12:9455446-9455468 CCCATAAATCAGACTAAGCTGGG + Intergenic
1093521920 12:20060981-20061003 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1093627297 12:21364357-21364379 CTGAAAACTCTCAATAAACTAGG + Intronic
1094506545 12:31066628-31066650 CCCATAAATCAGACTAAGCTGGG - Intergenic
1095880108 12:47126195-47126217 ATAAAAACTCACATTAAGCTAGG - Intronic
1096756498 12:53804028-53804050 CTGAAACCAGAGACTAAGTTTGG + Intergenic
1099185091 12:79507276-79507298 CTAAAAACTCTGAATAAACTAGG - Intergenic
1099697057 12:86036479-86036501 CTGAAAACTCCCAATAAACTAGG - Intronic
1099784719 12:87247177-87247199 CTTGAAACTCATACTAAGCAGGG - Intergenic
1099916259 12:88897639-88897661 CATAAAACTTAGACTAAGCATGG - Intergenic
1100558308 12:95720588-95720610 TTTAAAAATGAGACTAAGCTCGG - Intronic
1100604824 12:96143047-96143069 CTGACAACTGGGACTAAACTAGG - Intergenic
1104394671 12:128422237-128422259 CTGTGAGCTCAGTCTAAGCTAGG - Intronic
1105513051 13:21067084-21067106 CTCAAAACACAGACAAAGCCTGG - Intergenic
1105660932 13:22494338-22494360 TTGAAAACTCTCAATAAGCTAGG - Intergenic
1106638883 13:31561788-31561810 CTGAAAACTCTGAATAAACTAGG - Intergenic
1106679088 13:31991592-31991614 TTGTAATCTCAGACTTAGCTTGG + Intergenic
1106817218 13:33421905-33421927 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1106961670 13:35005774-35005796 CTGAAAAATGAGAATAAGTTAGG + Intronic
1107498534 13:40953135-40953157 CTGAAAATACAGAATTAGCTGGG - Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108307668 13:49154699-49154721 CTAAAAACTCTGAATAAACTAGG - Intronic
1108308202 13:49159798-49159820 CTAAAAACTCTGAATAAACTAGG - Intronic
1108545023 13:51484425-51484447 CTAAAAACTCTAAATAAGCTAGG - Intergenic
1108549585 13:51530319-51530341 CTAAAAACTCTGAGTAAACTAGG + Intergenic
1109329049 13:60904890-60904912 CTGAAAACTCTCAGTAAACTAGG + Intergenic
1109465585 13:62727725-62727747 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1110349453 13:74490268-74490290 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1110437451 13:75490880-75490902 CTGAAAACAATGACTGAGCTGGG - Intergenic
1111906341 13:94260247-94260269 CTGAATCCTCAGGCTGAGCTAGG - Intronic
1113641257 13:111958835-111958857 TTGCAAACTCAGACTCATCTAGG - Intergenic
1114360895 14:21971242-21971264 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1114762241 14:25329212-25329234 CTGAAAACTCTCAATAAACTTGG + Intergenic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1115179413 14:30605055-30605077 CTGAAAATACAAAATAAGCTGGG - Intronic
1116144113 14:41041584-41041606 CTGAAAACTCAGAATATTTTTGG - Intergenic
1116247390 14:42433421-42433443 CTAAAAACTCTGAATAAACTAGG + Intergenic
1116552898 14:46265211-46265233 CTAAAAACTCTGAATAAACTAGG + Intergenic
1116672690 14:47863590-47863612 CTGAAAGCTAAGACTAAGGGAGG + Intergenic
1116889865 14:50257659-50257681 TTTAAAACTCAGGCTAGGCTTGG - Intronic
1117107441 14:52412263-52412285 CAGGAAACTCAGCCCAAGCTGGG - Intergenic
1117165896 14:53033069-53033091 CAGGAAACTCAGACTTACCTAGG - Intergenic
1117446752 14:55810735-55810757 CTGAAAACTCTCAATAAACTAGG - Intergenic
1117489525 14:56232568-56232590 CTGAAAACTCTCAATAAACTAGG + Intronic
1119150217 14:72352330-72352352 CTGGAAACTAAGACTAGGATGGG - Intronic
1120188144 14:81415869-81415891 CTGAGAACTCAGAAAAAGCAAGG + Intronic
1120201977 14:81547258-81547280 CTGAAAACTCTAAATAAACTAGG + Intergenic
1123949739 15:25259564-25259586 CTAAAAACTCTCACTAAACTAGG + Intergenic
1123985663 15:25643961-25643983 ATGAAATCTCAGAAGAAGCTAGG + Intergenic
1124923892 15:34052306-34052328 TTAAAAACTCTGAATAAGCTAGG + Intronic
1125453962 15:39838642-39838664 CTAAAAACTCTGAATAAACTAGG + Intronic
1126074163 15:44892723-44892745 CTGAAAACTCTCAATAAACTAGG - Intergenic
1126401322 15:48273722-48273744 ATGAAAATTCAGACTTACCTAGG + Intronic
1126863060 15:52905997-52906019 CTGAAAACTCTCAATAAACTAGG + Intergenic
1129507581 15:76095295-76095317 CTAAAAACTCTGAATAAACTAGG - Intronic
1130897934 15:88184983-88185005 CTGAAGTCTCAGATGAAGCTAGG - Intronic
1132254335 15:100362275-100362297 CTAAAAACTCACAATAACCTAGG + Intergenic
1132680639 16:1140071-1140093 CTTAAAACACAGACTGAGCGCGG - Intergenic
1132810619 16:1795008-1795030 CAGAAAACGCAGACTCAGCAGGG + Intergenic
1133896170 16:9931263-9931285 CTGCAAGCTCTGAGTAAGCTAGG - Intronic
1134112881 16:11526882-11526904 CTGGAAACTCAGACAAGGCAGGG - Intergenic
1136174981 16:28510434-28510456 CTAAAAATACAGACCAAGCTCGG - Intronic
1136600203 16:31280899-31280921 CTGAAAACTCTAAATAAACTAGG - Intronic
1138231262 16:55338230-55338252 CTTAAAACTCAGTTTCAGCTGGG - Intergenic
1138939413 16:61772391-61772413 CTGAAAAGTGAGACAAAGCTAGG + Intronic
1139150248 16:64373454-64373476 TTGAAAAATCAGACAAAGCAAGG + Intergenic
1139154900 16:64429139-64429161 CTAAAAACTCAGCATAAGATAGG + Intergenic
1140669038 16:77256501-77256523 CTAAAAACTCTCAATAAGCTAGG - Intronic
1141388969 16:83648503-83648525 CTGAGCATTCAGACTAAGCCTGG - Intronic
1142221665 16:88857831-88857853 CTGAAGGCTAAGACTGAGCTGGG + Intronic
1142725015 17:1807049-1807071 CTAAAAATACAGAATAAGCTGGG - Intronic
1146013131 17:29211790-29211812 AGGAAAACTCAGAAAAAGCTGGG + Intergenic
1146188609 17:30745511-30745533 CTAAAAACTCAAAATTAGCTGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146541537 17:33700144-33700166 CTGAGATCCCAGACTAAGCTGGG + Intronic
1147019591 17:37520861-37520883 CTGAGAACTCAGTCTCAGGTGGG + Intronic
1147346542 17:39800603-39800625 CTGAAAACATAGACAAAGATGGG - Intronic
1148190880 17:45677897-45677919 GTGCAAACCCAGAATAAGCTGGG - Intergenic
1149114591 17:53077391-53077413 CTGATAATTCTGACTAAGATAGG + Intergenic
1149673741 17:58439643-58439665 CTGAAAATACAGAATTAGCTGGG - Intronic
1153441615 18:5125949-5125971 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1153621271 18:6980396-6980418 CTCAAAAATGAGACTAAGATTGG - Intronic
1156434794 18:37115474-37115496 CTAAAAACTCTCAATAAGCTAGG + Intronic
1158857723 18:61560117-61560139 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1159019869 18:63134511-63134533 CTGAGAACACACACTGAGCTCGG - Intronic
1160032881 18:75278140-75278162 CTGAAAAGACAGAGTAAACTGGG - Intronic
1160372497 18:78385813-78385835 ATAAAAACTCTCACTAAGCTAGG - Intergenic
1162396334 19:10419984-10420006 CTGAAAACACAGACAACCCTCGG + Intronic
1162897503 19:13774186-13774208 ATAAAAACTCAGACTAGGTTAGG - Exonic
1163610868 19:18300945-18300967 CTGAAATCTCAGACCAGGTTGGG - Intergenic
1164113083 19:22188321-22188343 CTAAAAACTCTCACTAAACTAGG + Intronic
1164178473 19:22798659-22798681 CTAAAAACTCAAAATAAGCCAGG + Intergenic
1164209714 19:23088312-23088334 TTGAAAACTAAAACTAGGCTGGG - Intronic
1164543098 19:29136537-29136559 CTGAAAACTCTCAATAACCTAGG + Intergenic
1165170547 19:33888877-33888899 CTGAAAACCCAGACTCAGAGAGG - Intergenic
1165973391 19:39653145-39653167 CTGAAAACTCTCAATAAACTAGG + Intergenic
1166616384 19:44251712-44251734 CTAAAAACTCTCAATAAGCTAGG + Intronic
1167284307 19:48590304-48590326 CTAAAAAATAAGACTAGGCTGGG + Intronic
1167287713 19:48607909-48607931 CTGAATCCTCACACCAAGCTGGG + Intronic
1167615564 19:50531041-50531063 CTGAAAAGTGAGCCTAGGCTGGG - Intronic
1167684635 19:50949107-50949129 CTGAAAACTCTGAGGAAGATGGG + Exonic
1168037179 19:53729266-53729288 CTGAAAATACAAACTTAGCTAGG - Intergenic
925411329 2:3641496-3641518 CTCCAAACTCTGACCAAGCTAGG - Intronic
926503917 2:13687129-13687151 CTAAAAACACAAAATAAGCTGGG + Intergenic
927775882 2:25902808-25902830 CTAAAAACACAGAATTAGCTGGG - Intergenic
930081512 2:47453073-47453095 CTGAAAACTCAACATAATCTAGG + Intronic
930162082 2:48168713-48168735 CTAAAAACTCAAAATTAGCTGGG + Intergenic
930586312 2:53271254-53271276 CTAAAAACTCTGAATAAACTAGG + Intergenic
931204306 2:60132374-60132396 CTAAAAACTCTGAATAAACTAGG - Intergenic
931558298 2:63529396-63529418 CTAAAAACTCTGAATAAACTAGG - Intronic
931558824 2:63534670-63534692 CTAAAAACTCTGAATAAACTAGG + Intronic
932211714 2:69937045-69937067 CTGAAGAGTCAGACGAAGCCAGG + Intronic
932776462 2:74530804-74530826 CTGAGGATTCAGACTAAGGTGGG + Exonic
933412826 2:81947361-81947383 CTAAAAACTCACAATAAACTTGG - Intergenic
935438234 2:103060169-103060191 CTGAAAATTCTCACTAAACTAGG + Intergenic
936613481 2:114025116-114025138 CAGAATTCTCAGACTAAGTTTGG - Intergenic
936806082 2:116333962-116333984 CTAAAAACTCTTAGTAAGCTAGG - Intergenic
938860808 2:135366507-135366529 CTGAATACTGAGATTAGGCTGGG + Intronic
939019594 2:136943032-136943054 CTAAAAACTCTCAATAAGCTAGG - Intronic
939193046 2:138939084-138939106 CTTAAAACTCTGAATAAACTAGG - Intergenic
940438680 2:153686822-153686844 CTAAAAACTCTCAATAAGCTAGG - Intergenic
941066785 2:160912342-160912364 CTCAAAACACAGACTAACCTTGG - Intergenic
941372397 2:164681658-164681680 CTGGAAACTAAGAATAAACTGGG + Intronic
941559697 2:167029386-167029408 CTAAAAACTCTCAATAAGCTAGG - Intronic
941845678 2:170129882-170129904 CTAAAAACTCTGAATAAACTAGG + Intergenic
943531915 2:189093082-189093104 CTGAGAACTTAGACTTGGCTGGG - Intronic
944164737 2:196706695-196706717 CTAAAAACTCTCAATAAGCTAGG - Intronic
944249244 2:197564673-197564695 CTGAAAACTCTCAATAAACTAGG - Intergenic
945367968 2:208979511-208979533 CTGAACACTCAGACTCACCCTGG - Intergenic
945490523 2:210449312-210449334 CTAAAAACTCTGAATAAACTAGG + Intronic
948436891 2:237959909-237959931 CTGAAAACTTGAACTAACCTTGG + Intergenic
1169417533 20:5430467-5430489 CTGAGAACTCAGAGAAAGCCAGG - Intergenic
1169564642 20:6840606-6840628 CTGAATACTTAGTCTAAGCCAGG - Intergenic
1170229010 20:14024567-14024589 CTAAAAACTCTCAATAAGCTAGG - Intronic
1172455938 20:35073459-35073481 CTGAAAACTCTCAATAAACTAGG - Intronic
1174271241 20:49370688-49370710 CTGAACACGCAGTCTGAGCTGGG - Exonic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1176692260 21:9928631-9928653 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
1177428518 21:20958528-20958550 CTGAAAACTCTCAATAAACTAGG + Intergenic
1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG + Intronic
1178445559 21:32638399-32638421 TTGAAAATTCAGAGTAGGCTGGG + Intronic
1182590015 22:31372027-31372049 ATAAAAACTCAGACTAGACTGGG + Intergenic
1184018992 22:41807997-41808019 CTGAAAATACAGAATTAGCTGGG + Intronic
1184065629 22:42118350-42118372 CTGAACTCCCAGACTTAGCTGGG + Intergenic
1185106790 22:48875478-48875500 CTAAAAACTGAGACTAATCAGGG + Intergenic
1185240621 22:49742485-49742507 CTGAAAACTCTCAATAAACTAGG + Intergenic
949187801 3:1214727-1214749 AAGAAAACTCAGAATAAGCTGGG - Intronic
949209026 3:1476349-1476371 ATGAAAACTCAAAAGAAGCTAGG - Intergenic
949302627 3:2602052-2602074 CTGAAAACTCTCAATAAACTAGG + Intronic
950802018 3:15560253-15560275 CTGAAAATACAGAATTAGCTGGG - Intergenic
951747455 3:25995307-25995329 CTAAAAACTCTCAATAAGCTAGG - Intergenic
952117274 3:30197826-30197848 GTGAAAACTGAGATTAAGATAGG - Intergenic
952372003 3:32731770-32731792 CTAAAAAATAAAACTAAGCTGGG - Intronic
952461206 3:33528250-33528272 CTAAAAACTCTCAATAAGCTAGG + Intronic
952941627 3:38449551-38449573 ATGAAAACACAGAGTAAGCTGGG - Intergenic
953554856 3:43936617-43936639 CTGAAAACTCTCAATAAACTAGG - Intergenic
954764780 3:52904816-52904838 CTGAAAACAAAGAATAACCTAGG - Exonic
955642618 3:61102236-61102258 CTAAAAACTCTGAATAAACTAGG - Intronic
956269781 3:67439197-67439219 CTAAAAACTCTGAATAAACTTGG + Intronic
956374225 3:68596941-68596963 CTGAAAAATCTGAATAAGCCTGG + Intergenic
957341583 3:78905247-78905269 CTAAAATCTAAGACTACGCTGGG + Intronic
957798164 3:85039160-85039182 CTAAAAACACAAAATAAGCTGGG - Intronic
957811269 3:85225782-85225804 CTAAAAACTCTCACTAAACTAGG - Intronic
957837468 3:85616281-85616303 TTGAAAACTCAGAATAAATTTGG - Intronic
957927953 3:86839458-86839480 ATGAAATCTCAATCTAAGCTTGG - Intergenic
958422630 3:93945619-93945641 CTAAAAACTCTCAATAAGCTAGG + Intronic
958694209 3:97507345-97507367 CTAAAAACTCTGAATAAACTAGG - Intronic
960770510 3:121188768-121188790 CTGAAAACTCTCAATAAACTAGG + Intronic
960864859 3:122189220-122189242 CTAAAAACTGAGGCTCAGCTAGG - Intronic
961992715 3:131209146-131209168 CTAAAAACTCTCAATAAGCTAGG - Intronic
962268248 3:133958788-133958810 CTGAAGATTCAGACAAATCTTGG + Intronic
962641643 3:137393109-137393131 CTGAAAACTCTCAATAAACTAGG - Intergenic
962641923 3:137396475-137396497 CTGAAAACTCTCAATAAACTAGG + Intergenic
963607089 3:147421025-147421047 CAGAAAACTCAAACTCAGCGTGG + Intronic
963928683 3:150979021-150979043 TTGAAAGCTCCCACTAAGCTAGG - Intergenic
964265892 3:154894932-154894954 CTAAAAACTCACAATAAACTAGG + Intergenic
964743728 3:159992102-159992124 CTGAAAATTCAGAATACGTTTGG - Intronic
965393389 3:168132250-168132272 CTAAAAACTCTGAATAAACTAGG + Intergenic
965878782 3:173362638-173362660 CTGAAAGCTCAGACTTGACTGGG - Intergenic
966150736 3:176865224-176865246 CTAAAAACTCTGAATAAACTAGG + Intergenic
966255493 3:177912418-177912440 CTAAAAACTCTGAATAAACTCGG + Intergenic
966450817 3:180059420-180059442 TTGAAAACTAAGGCTAAGATAGG - Intergenic
966477905 3:180371320-180371342 CTAAAAACTCTCAATAAGCTAGG + Intergenic
966539049 3:181068767-181068789 CTGAAAACTCAGACAGTGATGGG - Intergenic
966869629 3:184281801-184281823 ATGAAAACTAAGAGTAGGCTGGG + Intronic
967678881 3:192335716-192335738 CTGAAATCTCAGATCCAGCTGGG - Intronic
968124635 3:196149530-196149552 CTGAAGACTGAGACTAGGCCAGG + Intergenic
968255791 3:197270158-197270180 GTGAAAACTCAAAATAAACTTGG + Intronic
968596416 4:1488359-1488381 CCGAAAACTCAGTCTGAACTGGG - Intergenic
968899132 4:3422631-3422653 CTGAGGACTCTGACAAAGCTGGG - Intronic
970975344 4:22037028-22037050 CTGAAAACTCTCAATAAACTAGG - Intergenic
971648047 4:29233599-29233621 CTAAAAACTCTCAATAAGCTAGG + Intergenic
972189566 4:36573970-36573992 CTGAGAAATGAGACTAAGCATGG + Intergenic
973050394 4:45588408-45588430 CTGAAAACTCTCAATAAACTAGG + Intergenic
973938410 4:55876523-55876545 CTGAAAACTCAGACTAAGCTTGG - Intronic
974990201 4:69077960-69077982 CTAAAAACTCTCAATAAGCTAGG - Intronic
975306128 4:72850728-72850750 CTAAAAACTCACAATAAACTAGG + Intergenic
975511733 4:75201165-75201187 CTGAAAACTCTTAATAAACTAGG - Intergenic
975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG + Intergenic
977203521 4:94144647-94144669 CTGAAAACTCTTAATAAACTAGG - Intergenic
979010232 4:115357646-115357668 CTGAAGACTCAGACAGAGATTGG + Intergenic
979672879 4:123379665-123379687 CTTAGAACTCAGACCTAGCTAGG + Intergenic
979777468 4:124609016-124609038 ATGAAAACTGAAACTCAGCTAGG + Intergenic
980151299 4:129051907-129051929 CTAAAAACTCTCAATAAGCTAGG - Intronic
980332712 4:131430038-131430060 GTGAAAACTCAGACTAGGTGCGG - Intergenic
980364854 4:131788874-131788896 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
980414380 4:132465947-132465969 CTAAAAACTCACAATAATCTAGG - Intergenic
981446155 4:144840637-144840659 CTGAAAACTCTCAATAAACTAGG + Intergenic
981501955 4:145461444-145461466 CTAAAAACTCTGAATAAACTAGG + Intergenic
983212315 4:164971428-164971450 CTAAAAACACAGAATTAGCTGGG + Intronic
983363971 4:166762552-166762574 CTGAAAGCTCAGACTCAGTTTGG + Intronic
983881300 4:172936240-172936262 CTGAAAACTCTCAATAAACTAGG + Intronic
984903492 4:184605772-184605794 CTAAAAACTCCGAATAAACTAGG + Intergenic
986590012 5:9358759-9358781 CTGGAAAATAAGACAAAGCTTGG + Intronic
986675551 5:10181584-10181606 CTAAAAACTCTCAATAAGCTAGG + Intergenic
987458915 5:18182794-18182816 CTGAAGACAGAGACAAAGCTTGG - Intergenic
987956911 5:24751964-24751986 CTGAAAACTCTCAATAAACTCGG - Intergenic
988012856 5:25512815-25512837 CTAAAAACTCACAATAAGCTAGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989958208 5:50379443-50379465 CTGAAAACTCTCAATAAACTAGG + Intergenic
990239934 5:53806732-53806754 CTAAAAACTCTCAATAAGCTAGG + Intergenic
990606347 5:57414269-57414291 CTGAAAATTCAGAATATGTTGGG - Intergenic
990984456 5:61628192-61628214 CTAAAAACTCTGAATAAACTAGG + Intergenic
991445351 5:66694224-66694246 CTCATACCTCAGACTCAGCTGGG - Intronic
992236659 5:74716892-74716914 CTAAAAACTCAGATTGGGCTGGG + Intronic
992294475 5:75313899-75313921 CTGAAAATACAAAATAAGCTGGG - Intergenic
992422892 5:76624776-76624798 CTGAAAAAGCAGACTTGGCTGGG + Intronic
992963090 5:81974774-81974796 CTTAAAACTCAAAGGAAGCTTGG - Intronic
993323369 5:86503559-86503581 CTGAAAACTAGGAATAGGCTGGG - Intergenic
993998718 5:94752891-94752913 CTGAATTCTAAGACTAATCTGGG + Intronic
994585961 5:101709871-101709893 CTTAAAAATCACACTAAGTTTGG + Intergenic
994861525 5:105201763-105201785 CTGAAAACTCTCAATAAACTGGG + Intergenic
995211251 5:109541954-109541976 CTAAAAACTCTCAATAAGCTAGG + Intergenic
995240837 5:109884320-109884342 GTGAAAACTCAGACGAAACTCGG - Intronic
995471572 5:112507487-112507509 CTAAAAACTCTCAATAAGCTAGG + Intergenic
995563879 5:113412952-113412974 CTAAAAACTCTCAATAAGCTAGG - Intronic
995642620 5:114275015-114275037 CTAAAAACTCACAATAAACTAGG - Intergenic
995750204 5:115446009-115446031 CTAAAAACTCTCAATAAGCTAGG + Intergenic
996276964 5:121678674-121678696 CTAAAAACTCTGAATAAACTAGG - Intergenic
996406502 5:123110725-123110747 CTAAAAATACAGAATAAGCTGGG - Intronic
996440409 5:123483819-123483841 CTTGAAACTCAGCCTAAGCTAGG - Intergenic
996441365 5:123494932-123494954 CTGAAAAGTCAAAATCAGCTTGG + Intergenic
996689014 5:126317592-126317614 GAGAAAACTCAGACTGAGATAGG - Intergenic
997404005 5:133629153-133629175 CTAAAAACTCTCAATAAGCTGGG - Intergenic
997404076 5:133629956-133629978 CTAAAAACTCTCAATAAGCTAGG + Intergenic
997496677 5:134333494-134333516 CTAAAAACTCTGAATAAACTAGG - Intronic
998588223 5:143450470-143450492 CTTAAAAGTCAAACAAAGCTAGG - Intergenic
998792729 5:145782909-145782931 CTGTAAAATCAGACTTAACTGGG - Intronic
999193503 5:149766084-149766106 CTGAACCCTCAGGCAAAGCTTGG + Intronic
999964089 5:156789425-156789447 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002996488 6:2290494-2290516 CTAAAAACTCTGAGTAAACTAGG + Intergenic
1003105714 6:3213922-3213944 TTGAAATCTCAGAATAAGTTGGG + Intergenic
1004950453 6:20664889-20664911 CTTAAAACTCAGAGTAATCCAGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1007759583 6:44126114-44126136 CTGAAAACTCAGGCAAAGAAAGG + Intronic
1008225377 6:48908147-48908169 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1008474353 6:51920308-51920330 CTAAAAACTCTGAATAAACTAGG - Intronic
1008700627 6:54095375-54095397 ATGAAAAGTCAGTCTAAGGTGGG - Intronic
1008785466 6:55162297-55162319 CTAAAAACTCTCAATAAGCTAGG + Intronic
1009561684 6:65253861-65253883 CTGAAAAATCAGAAAAAGATAGG - Intronic
1009668106 6:66708854-66708876 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1010540280 6:77084656-77084678 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1010871789 6:81051581-81051603 TTGAAAACTTAGACTAACTTGGG - Intergenic
1011318352 6:86061972-86061994 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1011418096 6:87143576-87143598 CTGAAAACTCTCAATAAACTAGG + Intergenic
1011884968 6:92082248-92082270 CTAAAAACTCTGAATAAACTAGG + Intergenic
1013025403 6:106266811-106266833 CTAAAAACTCTCAATAAGCTAGG + Intronic
1013302268 6:108815268-108815290 CTAAAAACTCACAATAAACTAGG - Intergenic
1013388045 6:109652363-109652385 CTGAAAACTCTCAATAAACTAGG + Intronic
1013901536 6:115162821-115162843 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1014223175 6:118819301-118819323 CTAAAAACTCTCAATAAGCTAGG - Intronic
1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG + Intergenic
1016523537 6:144973883-144973905 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1016638292 6:146320146-146320168 CTAAAAAATCACAATAAGCTAGG - Intronic
1017372646 6:153731495-153731517 CTAAAAACTCTGAATAAACTAGG + Intergenic
1017384506 6:153867849-153867871 CTGAAAACTCTCAATAAACTAGG + Intergenic
1019651906 7:2164344-2164366 CAGAAAACTGAGGCTCAGCTGGG - Intronic
1021884028 7:25120961-25120983 CTAAAAACACAAAATAAGCTGGG + Exonic
1023064333 7:36361593-36361615 CTAAAAACTCAAAAGAAGCTAGG + Intronic
1024423757 7:49201818-49201840 GTGAAAACCCAAACTAAGATAGG - Intergenic
1024591618 7:50890814-50890836 CTGAAAACTCTCAATAAGCTAGG + Intergenic
1024682222 7:51704290-51704312 CTGAAAACTCACAATAAATTGGG - Intergenic
1024738455 7:52330697-52330719 CTAAAAACTCTCAGTAAGCTAGG + Intergenic
1025118209 7:56276574-56276596 CTGGAAACTCAGCCTAGGGTTGG - Intergenic
1026278423 7:68900754-68900776 GTGAAAACTCATTCTAGGCTGGG + Intergenic
1026429634 7:70331779-70331801 CTGAAAACTCTCAATAAACTAGG + Intronic
1027380687 7:77606113-77606135 CTGAAAACACATAATTAGCTGGG - Intronic
1027511569 7:79088691-79088713 CTGAAAACTCTCAATAAACTAGG - Intronic
1027739075 7:81977232-81977254 CTAAAAACTCATAATAAACTAGG - Intronic
1028080650 7:86571139-86571161 CTAAAAACTCTGAATAAACTAGG + Intergenic
1028160322 7:87476908-87476930 CTGAGAACTCAGACAAGCCTTGG - Intronic
1028648607 7:93125287-93125309 CTAAAAACTCCCAATAAGCTAGG + Intergenic
1028734500 7:94192016-94192038 CTGAAAACTCTCAATAAACTAGG + Intergenic
1028780777 7:94733812-94733834 TTGAAAACTCTCAATAAGCTAGG + Intergenic
1028796198 7:94907443-94907465 CTGCAGACTCAGACTAAGTGGGG + Intronic
1029088745 7:98031910-98031932 CTTAAAACTCAAACCAGGCTGGG + Intergenic
1029322291 7:99774651-99774673 CTAAAAACTCTGAATAAACTAGG + Intronic
1029556283 7:101271990-101272012 TTGAAAAATCAGAGTAGGCTGGG + Intergenic
1030281708 7:107782709-107782731 CTGAAAGCACAAACTAAACTAGG - Intronic
1031391719 7:121223137-121223159 CTAAAAACTCAAAATAAACTAGG - Intronic
1033091060 7:138386389-138386411 CTGAAAACACAAAATTAGCTGGG - Intergenic
1033124516 7:138696075-138696097 CTAAAAATTCAAACTAGGCTGGG - Intronic
1033705384 7:143881507-143881529 GTGAAAAATAAGACTGAGCTGGG - Intronic
1034039767 7:147865108-147865130 CTAAAAACTCCCAATAAGCTAGG - Intronic
1034111942 7:148545695-148545717 CTGAAAAATCATCCAAAGCTCGG + Intergenic
1035235632 7:157496108-157496130 CTAAAAACACAGAATCAGCTGGG - Intergenic
1036723358 8:11199438-11199460 CTAAAATCTCCTACTAAGCTTGG + Intronic
1037087382 8:14869398-14869420 CTAAAAACTCACAATAAACTAGG + Intronic
1040473449 8:47756132-47756154 CTAAAAACTCTCACTAAACTAGG - Intergenic
1040488194 8:47894608-47894630 CTGAATACTGAGACTCAGCGTGG - Intronic
1040563710 8:48547167-48547189 CAGAAAACTCAGAAGTAGCTAGG + Intergenic
1040569482 8:48595137-48595159 CTGAAGACTCAGTGTCAGCTCGG - Intergenic
1042183503 8:66114316-66114338 CTGAAAAGTCAGACGAAGTCAGG + Intergenic
1043748876 8:83910097-83910119 CTGAAAAGTCACACTCAGTTAGG - Intergenic
1043785379 8:84391765-84391787 CTGAAGTCTCAGAATGAGCTAGG - Intronic
1044048098 8:87463267-87463289 CTAAAAACTCTGAATAAACTAGG - Intronic
1044405601 8:91822444-91822466 CTGAAAACTCTCAATAAACTAGG + Intergenic
1044440983 8:92223227-92223249 CTGAAAACTCTCAATAAACTAGG - Intergenic
1044470281 8:92559011-92559033 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1044834525 8:96282873-96282895 CTGGAAGCTCAGACTATGGTTGG - Intronic
1045819956 8:106324754-106324776 CTGATCACTTAGACTAGGCTTGG + Intronic
1046067617 8:109215208-109215230 CTGAAAACTCTCAGTAAACTAGG - Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046870778 8:119203872-119203894 CTGAAAACTCTCCCCAAGCTGGG + Intronic
1046881237 8:119310728-119310750 CTAAAAACTCTCACTAAACTAGG + Intergenic
1047812790 8:128428695-128428717 CTGACACCTCAGACTGTGCTGGG + Intergenic
1047923688 8:129661190-129661212 TGGAAAATTCAGACTAAGGTAGG + Intergenic
1050300120 9:4249800-4249822 CTAAAAACTCTCAATAAGCTAGG - Intronic
1053629204 9:39914731-39914753 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
1053776560 9:41548840-41548862 CTGGAAACTGAGAGAAAGCTTGG - Intergenic
1054214683 9:62335971-62335993 CTGGAAACTGAGAGAAAGCTTGG - Intergenic
1054365170 9:64329645-64329667 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
1054672798 9:67819378-67819400 CTGGAAACTGAGAGAAAGCTTGG + Intergenic
1055123755 9:72694466-72694488 TTAAAAACTAAGAATAAGCTTGG + Intronic
1055160000 9:73114833-73114855 CTCAATACTCAGATTAACCTGGG - Intergenic
1056409829 9:86313989-86314011 CTGAATACTTAGAATATGCTAGG + Intronic
1056417780 9:86393930-86393952 CTGAAAACTCTCAATAAACTAGG + Intergenic
1056594891 9:87999334-87999356 CTGAATACACAGAATAACCTGGG - Intergenic
1060624677 9:125100927-125100949 CTAAAAACTGTGACTGAGCTGGG + Intronic
1060797536 9:126522761-126522783 CTGGGAGCTCAGACTGAGCTGGG - Intergenic
1061561743 9:131408878-131408900 CTGAAAACACAAAATTAGCTGGG - Intronic
1186340060 X:8635322-8635344 CTGAAAACTAATACTTATCTAGG - Intronic
1187635243 X:21220798-21220820 CTAAAAACTCTGAATAAACTAGG - Intergenic
1188098262 X:26048760-26048782 CTGAAACGTCAGACACAGCTGGG + Intergenic
1188504098 X:30862560-30862582 CTGAAGGCTCTGACAAAGCTAGG - Intronic
1188845346 X:35065431-35065453 ATGAAAAGTCCGTCTAAGCTTGG - Intergenic
1188969216 X:36592760-36592782 CTAAAAACTCTTAATAAGCTAGG + Intergenic
1189039398 X:37526639-37526661 CTAAAAACTCTCAATAAGCTAGG - Intronic
1189501627 X:41566044-41566066 CTAAAAACTCAGAATAAGCTAGG + Intronic
1190459125 X:50653745-50653767 CTAAAAACTCTCAATAAGCTAGG - Intronic
1190840992 X:54144123-54144145 CTAAAAACTCTCAATAAGCTAGG + Intronic
1191115743 X:56850787-56850809 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1191139264 X:57098572-57098594 CTAAAAACTCTGAATAAACTAGG + Intergenic
1191606508 X:63068300-63068322 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1191768506 X:64729452-64729474 TTGAAAACTCTCAATAAGCTAGG - Intergenic
1191819095 X:65283283-65283305 CTGAAAACTCTCAGTAAACTAGG + Intergenic
1191874290 X:65779299-65779321 CTGAAAACTCTCAGTAAACTAGG + Intergenic
1191987588 X:66999506-66999528 CTGCAAACTCAGTATAACCTGGG + Intergenic
1192138717 X:68630266-68630288 CTGAGGACTGAGACTAAGCTGGG - Intergenic
1192147066 X:68689027-68689049 CTGAGGACTGAGACTAAGCTGGG + Intronic
1192982514 X:76361229-76361251 GTAAAAACTCTGAATAAGCTAGG - Intergenic
1193281163 X:79652578-79652600 CTAAAAACTCTGAATAAACTAGG - Intergenic
1193303846 X:79925949-79925971 CTAAAAACTCTGAATAAACTAGG + Intergenic
1193737737 X:85179940-85179962 ATGAATACTCAAACTATGCTAGG - Intergenic
1193907120 X:87257546-87257568 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1194230911 X:91322529-91322551 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1195149538 X:102052066-102052088 CTAAAAACTCTCAATAAGCTAGG - Intergenic
1195198604 X:102523901-102523923 TTGAAAACTCTGAATAAACTAGG + Intergenic
1196088894 X:111717410-111717432 CTCCAAACTCAGACTAAGGGAGG - Intronic
1197490098 X:127105850-127105872 CTAAAAACTCTCAATAAGCTAGG + Intergenic
1197991658 X:132325309-132325331 CTAAAAACTCACAATAAACTAGG + Intergenic
1198519368 X:137437240-137437262 CTAAAAACTCCCAATAAGCTAGG + Intergenic
1199282793 X:146021883-146021905 CTGAAAACTCAAACATGGCTGGG - Intergenic
1201543613 Y:15136267-15136289 CTGAAAACTCTCAATAAACTAGG + Intergenic