ID: 973942032

View in Genome Browser
Species Human (GRCh38)
Location 4:55920822-55920844
Sequence AGCTGAAGTCAGACAAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973942032_973942039 30 Left 973942032 4:55920822-55920844 CCCTGGCTTGTCTGACTTCAGCT No data
Right 973942039 4:55920875-55920897 ACATTTGCTACCTGCCCACTTGG No data
973942032_973942035 -6 Left 973942032 4:55920822-55920844 CCCTGGCTTGTCTGACTTCAGCT No data
Right 973942035 4:55920839-55920861 TCAGCTGTGCTTCCCTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973942032 Original CRISPR AGCTGAAGTCAGACAAGCCA GGG (reversed) Intergenic
No off target data available for this crispr