ID: 973942033

View in Genome Browser
Species Human (GRCh38)
Location 4:55920823-55920845
Sequence CAGCTGAAGTCAGACAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973942033_973942040 30 Left 973942033 4:55920823-55920845 CCTGGCTTGTCTGACTTCAGCTG No data
Right 973942040 4:55920876-55920898 CATTTGCTACCTGCCCACTTGGG No data
973942033_973942039 29 Left 973942033 4:55920823-55920845 CCTGGCTTGTCTGACTTCAGCTG No data
Right 973942039 4:55920875-55920897 ACATTTGCTACCTGCCCACTTGG No data
973942033_973942035 -7 Left 973942033 4:55920823-55920845 CCTGGCTTGTCTGACTTCAGCTG No data
Right 973942035 4:55920839-55920861 TCAGCTGTGCTTCCCTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973942033 Original CRISPR CAGCTGAAGTCAGACAAGCC AGG (reversed) Intergenic
No off target data available for this crispr