ID: 973946602

View in Genome Browser
Species Human (GRCh38)
Location 4:55962928-55962950
Sequence CCATATACCCACCTTTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973946598_973946602 21 Left 973946598 4:55962884-55962906 CCTTCATCTCTCTGTGGCTCAAA 0: 1
1: 0
2: 3
3: 53
4: 438
Right 973946602 4:55962928-55962950 CCATATACCCACCTTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973946602 Original CRISPR CCATATACCCACCTTTACAT TGG Intronic
No off target data available for this crispr