ID: 973947541

View in Genome Browser
Species Human (GRCh38)
Location 4:55974093-55974115
Sequence CTGTATCCTTAGCTGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973947536_973947541 24 Left 973947536 4:55974046-55974068 CCTACTACAATTAGAATAGTTGT 0: 1
1: 0
2: 0
3: 15
4: 167
Right 973947541 4:55974093-55974115 CTGTATCCTTAGCTGGTGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 161
973947538_973947541 -3 Left 973947538 4:55974073-55974095 CCTTGGCTATGCTTTTTATACTG 0: 1
1: 0
2: 1
3: 14
4: 238
Right 973947541 4:55974093-55974115 CTGTATCCTTAGCTGGTGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973947541 Original CRISPR CTGTATCCTTAGCTGGTGCT GGG Intronic
901929523 1:12588096-12588118 CTGTGTCCCTACCTGGTGCCCGG + Intronic
907469040 1:54660227-54660249 CTGTATCCCTACATGGTGGTAGG + Intronic
908820637 1:68082643-68082665 ATGTCTCCTTAGCTGCTTCTTGG + Intergenic
909094488 1:71270723-71270745 CTGTATCCTGAGCTCTTGTTCGG + Intergenic
910436548 1:87211430-87211452 CTGTATCCTCAGCTGGGGGAAGG + Intergenic
910499642 1:87875313-87875335 CTGTGTCCTTACATGGTGGTAGG + Intergenic
910596233 1:88983631-88983653 CTGCATCCTTAGCGTCTGCTGGG + Exonic
915500268 1:156311122-156311144 CTGGACCCTCAGCTGGTGCCAGG - Exonic
915640855 1:157224889-157224911 CTTTATCATTAGGAGGTGCTAGG + Intergenic
921516288 1:216096607-216096629 CTGTATCCTTTGCAGGGGCATGG + Intronic
922974166 1:229769757-229769779 CTGTCTCCCCAGCTGCTGCTTGG - Intergenic
923713671 1:236406896-236406918 CTGTATCATTACTTGTTGCTTGG + Intronic
1063459808 10:6207941-6207963 CTGAGTCCTAAGATGGTGCTTGG + Intronic
1064514860 10:16136093-16136115 CAGTATCCTTAGTAGGTTCTTGG + Intergenic
1065005205 10:21373294-21373316 CTGAATGCTTAGCTGGGGCTGGG - Intergenic
1067304972 10:45055115-45055137 CGGCAGCCTGAGCTGGTGCTGGG - Intergenic
1068529553 10:58169614-58169636 CTGAATCCTTTGATGCTGCTGGG + Intergenic
1069216046 10:65822919-65822941 CTGTGTTCTTATCTGGAGCTTGG + Intergenic
1069637164 10:69931921-69931943 CTGTATTCTCATCTGGAGCTAGG + Intronic
1071386362 10:85125253-85125275 CAGTATCCTGACCTGATGCTTGG + Intergenic
1073690396 10:105801809-105801831 ATGTATGCTTAGTTGGTGCAAGG - Intergenic
1074654831 10:115573099-115573121 CTGTATCCTAAGCTCTTGCCAGG + Intronic
1074894427 10:117762679-117762701 GTCTATCCTTACCTTGTGCTGGG - Intergenic
1075196400 10:120363010-120363032 CTGTATCCTTATCTGGTAGAAGG - Intergenic
1075527985 10:123202286-123202308 CTGTATCCTTAGCCCATCCTGGG + Intergenic
1076098977 10:127758752-127758774 CTGTCCCCTTAGCTGTTTCTGGG + Intergenic
1076529405 10:131134677-131134699 CTGTCTGTTTAGCAGGTGCTGGG + Intronic
1076536787 10:131183617-131183639 CTGTATTCTGAGCTTGTTCTGGG - Intronic
1078470665 11:11583564-11583586 ATGTATCCTTTGCTGGGGCCAGG - Intronic
1080584895 11:33672745-33672767 CTGTATCAATAACTGGTGGTGGG - Exonic
1080789810 11:35512265-35512287 ATATATCCTTAGTGGGTGCTGGG - Intronic
1081847703 11:46252597-46252619 CTGGATCCTGAGCTGGGGCTGGG + Intergenic
1084492378 11:69485895-69485917 CTGCATCCTTAGCTGCAGCAGGG + Intergenic
1088545332 11:110953350-110953372 CTGTTGGCTGAGCTGGTGCTTGG + Intergenic
1088965249 11:114714143-114714165 ATGTATCATTAGCTTGTGGTTGG + Intergenic
1092087233 12:5773132-5773154 CTGTAGCCGGAGCTGGTGCATGG - Intronic
1092386182 12:8037412-8037434 CAGTGTCCTAACCTGGTGCTAGG + Intronic
1096349044 12:50878953-50878975 CTGTATCCTTACGTGGTGGAAGG - Intronic
1097199106 12:57263283-57263305 CTGTAGCCTATGGTGGTGCTGGG - Intronic
1099781133 12:87197009-87197031 CTGTATACTAAGCTTGTTCTAGG + Intergenic
1100776234 12:97978264-97978286 ATGTATCCTTACCATGTGCTGGG - Intergenic
1100921479 12:99493232-99493254 CTGTATCTTTAGCAGATGCAAGG + Intronic
1102041460 12:109803574-109803596 CTGTAGTCTTAGCTGCTACTTGG - Intronic
1102522387 12:113486562-113486584 CTCTCTCCTTACCTGGGGCTTGG + Intergenic
1103978748 12:124721996-124722018 CTCTATTCTTAGCTGGTCATTGG - Intergenic
1104047156 12:125171559-125171581 CTGTGTCCTCATCTGGAGCTTGG + Intergenic
1106641997 13:31594205-31594227 CTCTATCCTAAGCTGGTTCCTGG - Intergenic
1108333268 13:49412030-49412052 CTGTCTCCTTTGCTGGCTCTGGG + Intronic
1110752595 13:79132450-79132472 CTGTGTCCTTATCTGGTGAAGGG + Intergenic
1111117636 13:83801782-83801804 CTGTATCCTTACATGGTGAAAGG - Intergenic
1116872913 14:50084782-50084804 CTCAAGCCTTCGCTGGTGCTAGG + Intronic
1119886203 14:78145031-78145053 CTGTATCCCTTGGTGGTGGTGGG + Intergenic
1121164374 14:91777774-91777796 CTGTAACCTTAGCTGGTAGAAGG + Intronic
1122674924 14:103404678-103404700 CTGTATCCTTATCTAGTGAATGG + Intronic
1125855629 15:42946766-42946788 CTGTATCCTTCCCTGGTGGTAGG - Intronic
1129589553 15:76903515-76903537 CTGTCTCCTTACATGGTGCAAGG - Intronic
1130690024 15:86074232-86074254 CTGTATCCTCAGGTGGTGAAAGG + Intergenic
1131388198 15:92025269-92025291 CTGTATCCTTAAGTGCTTCTTGG - Intronic
1134237056 16:12474814-12474836 GTGTATCCTTGGAAGGTGCTAGG + Intronic
1137465075 16:48700349-48700371 CTGCATCCTTAGCTGGGGGAGGG + Intergenic
1137620460 16:49873346-49873368 TTGTATCCTTAGCTCGTTTTAGG + Intergenic
1138238506 16:55406739-55406761 CTGTATCGTCAGCCGGTTCTGGG + Intronic
1142473117 17:174117-174139 CTTTATTCTGAGCTGGTGATGGG + Intronic
1143631124 17:8140911-8140933 CTGGATCCTAGGCTGGTGATGGG + Exonic
1144628939 17:16860413-16860435 GTGTATCCTTAGCTCAGGCTGGG + Intergenic
1144652470 17:17015702-17015724 GTGTATCCTTAGCTCAGGCTGGG - Intergenic
1144750299 17:17643955-17643977 CTGTAACCTTATTTGGTGATAGG + Intergenic
1144947718 17:18978274-18978296 CTGCTTCCACAGCTGGTGCTGGG + Exonic
1145160513 17:20570980-20571002 GTGTATCCTTAGCTCAGGCTGGG + Intergenic
1146527429 17:33578945-33578967 CTGCATCCTCACCTGGTCCTAGG + Intronic
1150584050 17:66501584-66501606 CTGTCTTCTTACCTGGTGTTGGG + Intronic
1152160285 17:78664522-78664544 CTCCATCCTAAGCTGGGGCTGGG - Intergenic
1158451074 18:57565876-57565898 CTGTATATTTAACTGGAGCTGGG - Intronic
1160074296 18:75657766-75657788 CTGCATCATTTGCTGGTGCGAGG + Intergenic
1160078681 18:75702914-75702936 TTGTATCCTCACCTGGAGCTGGG + Intergenic
1162071538 19:8155235-8155257 CTGTATTCTTTCCTGGTGGTGGG - Intronic
1162213414 19:9112041-9112063 CTGAATACTTAGGAGGTGCTGGG + Intergenic
1162908578 19:13837393-13837415 CTGTATCTTGCCCTGGTGCTGGG - Intergenic
1163367134 19:16881464-16881486 CTGTGTCCTTATCTGCTGCTCGG - Intergenic
1165386811 19:35514622-35514644 CTGTATCCCGAGCTGGGACTGGG - Intergenic
925098483 2:1226431-1226453 CTGTATTCCCAGTTGGTGCTGGG - Intronic
929520258 2:42643228-42643250 CAGTTTCCTTTGCTGGGGCTTGG + Intronic
931432374 2:62218464-62218486 CTGTTTCCTGAGGTGGGGCTGGG + Intronic
933294444 2:80473110-80473132 CTGCATCCTTATCTGAAGCTAGG + Intronic
935328819 2:101961689-101961711 CTGTGCCATTTGCTGGTGCTGGG + Intergenic
936449986 2:112626733-112626755 CCGTCTCCTAAGCAGGTGCTGGG - Intergenic
937840419 2:126519177-126519199 CTGTATCCTGAGCTCTTGTTTGG - Intergenic
939039708 2:137173303-137173325 GTGTTTCCTTAGCTGGAGCTGGG - Intronic
940316401 2:152331999-152332021 CTGTCTTCCTAGCTGCTGCTAGG - Intergenic
940323207 2:152399119-152399141 CTGGACCCTGAGCTGGTGCTGGG + Intronic
948445322 2:238028086-238028108 CTGTCTCCTGAGCTGTTGCTGGG + Intronic
1172646314 20:36472378-36472400 CTGTATTCTTAGCTGCTTGTGGG + Intronic
1172784340 20:37456726-37456748 CTGTGTCCTTACATGGTGCAAGG + Intergenic
1172866863 20:38106760-38106782 CTGCATGGTTTGCTGGTGCTGGG + Intronic
1176126051 20:63475328-63475350 CTGTCTCCTCCGCTGGAGCTGGG - Intergenic
1177997030 21:28113056-28113078 CTGTATCCTTAGCAGTTACCAGG - Intergenic
1179503649 21:41825372-41825394 CTGAATCCTGAGCTAGTGCCAGG + Intronic
1179941447 21:44641061-44641083 CTGCATCCAGAGCTGATGCTGGG - Intronic
1181172484 22:21017484-21017506 CTCCATCCTGAGCAGGTGCTGGG + Intronic
1181769465 22:25114854-25114876 CAGTATCCGTGGCTGGGGCTGGG + Intronic
1184456993 22:44616483-44616505 CTGTTTCCTTAGCAGGCACTGGG - Intergenic
1185080092 22:48704936-48704958 CTGTGTCCTGAGATGGTGCAGGG + Intronic
950430844 3:12950078-12950100 CTGTGTACTTAGCTTGTGCTGGG - Intronic
953809109 3:46096808-46096830 CTATATCCATCGCTGGTGATGGG - Intergenic
954945703 3:54422338-54422360 TTGTATCCGTCTCTGGTGCTAGG + Intronic
956722094 3:72127101-72127123 TTGTATCATTATTTGGTGCTGGG - Intergenic
957570797 3:81945492-81945514 CTTTGTCCTTAGCTGATCCTAGG + Intergenic
957909173 3:86599757-86599779 CTTTATCCTTAACTTATGCTTGG - Intergenic
960338697 3:116448410-116448432 CTGTTTCCATTGCTGGTGCTAGG + Intronic
960358194 3:116678880-116678902 CTGTATCCTGAGCTCTTGTTGGG - Intronic
962416090 3:135183379-135183401 CTCTATATTTAGCTGGTGCAGGG - Intronic
965517694 3:169639219-169639241 CTGAATCCATCGCTGGAGCTTGG - Intronic
968913130 4:3485768-3485790 CTGGTTCCTTAGCTGGGGGTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969486642 4:7475951-7475973 CAGTCTCCTTGGCTGGGGCTGGG + Intronic
972053043 4:34764600-34764622 CTGTATCCTGAGCTCTTACTGGG - Intergenic
972624029 4:40778527-40778549 CTGTATCCTCAGATGGTGAAAGG - Intronic
973296100 4:48522317-48522339 GTGTAACCATAGCTGGTGCCTGG + Intronic
973947541 4:55974093-55974115 CTGTATCCTTAGCTGGTGCTGGG + Intronic
976163641 4:82230243-82230265 CTGTATCCATAGCAGATGCTTGG - Intergenic
978494786 4:109347267-109347289 CTGCATCCTTAGCATCTGCTGGG + Intergenic
980097298 4:128504583-128504605 CTGTATCCTGAGCTCTTGTTTGG + Intergenic
981115628 4:140987523-140987545 CTTTATCAATAACTGGTGCTGGG + Intronic
981917675 4:150052402-150052424 CTATATCCTTAGCTGTGTCTAGG + Intergenic
982925651 4:161334433-161334455 CTGTATCTTTAGCTTTAGCTAGG - Intergenic
983237358 4:165194620-165194642 CTGAAGCCTTAGCTTGTGCTTGG - Intronic
983702271 4:170612374-170612396 GTGTGTCTTTAGCTGGTGGTAGG + Intergenic
986185596 5:5433560-5433582 CTGTATTTTTAGCTGGTTTTAGG + Intronic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
988038430 5:25858001-25858023 CTGTATCCTGAGCTCTTGCCTGG - Intergenic
989419096 5:41214993-41215015 CTAGATTCTTAGTTGGTGCTGGG - Intronic
993151893 5:84172948-84172970 CTGTCTCCTTTGCTGGCTCTGGG + Intronic
995121142 5:108536310-108536332 CTGTATCCTGAGCTCTTGCTTGG - Intergenic
998096994 5:139401636-139401658 CTGTATCCTCAGCTGGGGACAGG + Intronic
998567793 5:143231514-143231536 CAGCCTCCTTGGCTGGTGCTGGG + Intergenic
999254030 5:150199606-150199628 CTGTATCCTGACCCAGTGCTTGG + Intronic
999383604 5:151139144-151139166 CTGTATGCTGGGCTCGTGCTAGG - Intronic
1001555098 5:172631735-172631757 CTGCAGCCTCAGCTGGTCCTGGG + Intergenic
1003150728 6:3546667-3546689 CTGTATACCTAGTTGGTTCTAGG + Intergenic
1005592718 6:27345449-27345471 CAGTATCCATAGCTGGAGTTTGG + Intergenic
1005655597 6:27933260-27933282 CTGGCTCCTTATCTGGGGCTGGG + Intergenic
1007782022 6:44259878-44259900 CTGTTTCCTTAGTTGGTCCAAGG - Intronic
1009759506 6:67985526-67985548 CTGTATCCTCACATGGTGGTAGG - Intergenic
1011109175 6:83817999-83818021 TTGAATCCTTAACTGGTGTTTGG + Intergenic
1012522075 6:100134104-100134126 CTGTAGACTTACTTGGTGCTTGG - Intergenic
1019335768 7:481774-481796 CTGCATCCCTTGCTGGTCCTTGG + Intergenic
1020356548 7:7282073-7282095 CTGTATCCTTAGATGGTAAAAGG + Intergenic
1026565903 7:71489633-71489655 ATGTCTCGTTGGCTGGTGCTGGG - Intronic
1026759286 7:73114364-73114386 CTGAGTCCATTGCTGGTGCTGGG + Intergenic
1027088122 7:75279109-75279131 CTGAGTCCATTGCTGGTGCTGGG - Intergenic
1027810100 7:82885376-82885398 CTGTATCCCTTTCTGGAGCTTGG - Intronic
1029960614 7:104686227-104686249 CTGTTTCTTTAGCTGGTGATGGG - Intronic
1031323792 7:120366360-120366382 CTGTATTCTCAGCTGCTACTTGG + Intronic
1038328222 8:26588392-26588414 CTGTATTCGAATCTGGTGCTTGG + Intronic
1040867931 8:52069773-52069795 CCTTATCCTGTGCTGGTGCTGGG + Intergenic
1043201913 8:77381074-77381096 CTGTTTCTTTAGGTGGTTCTAGG - Intergenic
1044208998 8:89527571-89527593 CTCTATCTTTATCTGGTACTAGG - Intergenic
1044790121 8:95838569-95838591 CAGTTTCCTTGGCTGTTGCTGGG - Intergenic
1047357773 8:124139652-124139674 CTCTCTCCTTAGCTGGTGGATGG + Intergenic
1049513172 8:143039878-143039900 CTGTAACCTTCCCTGGTTCTGGG - Intronic
1049560196 8:143306487-143306509 CTGTGTCCTGAGCTGTGGCTTGG + Intronic
1050084317 9:1948915-1948937 CTATAAACTTAGCTGGTCCTGGG + Intergenic
1051886730 9:21901003-21901025 CTGCATCCTTAGGTGGGCCTTGG - Intronic
1052605110 9:30689278-30689300 CTGCATCCTTAGCATCTGCTGGG - Intergenic
1057274539 9:93669314-93669336 CTGGCTCCTGAGCTGGGGCTGGG + Intronic
1057505708 9:95631801-95631823 CTGTATCCTAAGCTGGTTGGGGG + Intergenic
1057895252 9:98903992-98904014 CTGTTTCCTTACCTGGGGATTGG - Intergenic
1058626782 9:106941869-106941891 CTGTAGACTTAGCTGTTTCTAGG - Intronic
1060955035 9:127632674-127632696 CGGAATCCTTATCTGGTGGTAGG - Intronic
1062479288 9:136744032-136744054 CTTTATTCTGAGCTGGTGCTGGG + Exonic
1062715227 9:138006883-138006905 CTGTATCCTTCTGTGGGGCTGGG + Exonic
1187241311 X:17516284-17516306 GTGCATCCTTAGCTGATACTTGG + Intronic
1189954432 X:46263149-46263171 CTGTATCCTGAGCTCTTGCCCGG + Intergenic
1192307373 X:69976401-69976423 CTCTATCGTTAGCTGGAGTTTGG + Intronic
1198462740 X:136879037-136879059 CTGCATCCTTAGCGTCTGCTGGG + Exonic
1201366844 Y:13216311-13216333 CTGTATGCTTAAGTGGTGCCAGG - Intergenic