ID: 973947833

View in Genome Browser
Species Human (GRCh38)
Location 4:55977986-55978008
Sequence ATGCTGAAGGCTGTAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973947833_973947839 15 Left 973947833 4:55977986-55978008 CCTGCCCTTACAGCCTTCAGCAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 973947839 4:55978024-55978046 ATGTGCATGTGTGTGTTTAGGGG No data
973947833_973947838 14 Left 973947833 4:55977986-55978008 CCTGCCCTTACAGCCTTCAGCAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 973947838 4:55978023-55978045 CATGTGCATGTGTGTGTTTAGGG 0: 1
1: 5
2: 30
3: 235
4: 1439
973947833_973947837 13 Left 973947833 4:55977986-55978008 CCTGCCCTTACAGCCTTCAGCAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG 0: 1
1: 7
2: 63
3: 318
4: 2193
973947833_973947840 22 Left 973947833 4:55977986-55978008 CCTGCCCTTACAGCCTTCAGCAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 973947840 4:55978031-55978053 TGTGTGTGTTTAGGGGACAGTGG 0: 1
1: 3
2: 9
3: 152
4: 1149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973947833 Original CRISPR ATGCTGAAGGCTGTAAGGGC AGG (reversed) Intronic
901325109 1:8360930-8360952 AGCCTGCAGGCTGTGAGGGCCGG + Exonic
903349506 1:22709833-22709855 GTGATGAAGGCTGTCAGAGCAGG + Intergenic
903471096 1:23587986-23588008 ATCCTGAAGGCAGGAAGGGAAGG + Intronic
904992675 1:34606141-34606163 ATGCTGGAAGCTGTAGGGGAAGG - Intergenic
906758535 1:48347263-48347285 ATGCAGAAGGCTGAAAGTGGGGG + Intronic
910004676 1:82381727-82381749 ATGCTGCAGGATTTAGGGGCAGG - Intergenic
911326500 1:96475057-96475079 TGGAGGAAGGCTGTAAGGGCGGG - Intergenic
913358795 1:117955302-117955324 AAGCTGAAGGCTATAAAGGAAGG - Exonic
919112156 1:193234571-193234593 ATGCTGGAGGCTTCAATGGCTGG - Intronic
921042572 1:211448054-211448076 ATGATGAATGCTGCAAGGACTGG - Intergenic
921809572 1:219497300-219497322 ATACTGAACACTTTAAGGGCTGG - Intergenic
923796991 1:237166453-237166475 AAGCTGAAGTCTCTCAGGGCTGG + Intronic
1063389791 10:5641723-5641745 AGGCTGAAGGCTGGAGGGGATGG + Intronic
1064987480 10:21225740-21225762 GTGGTGAATGCTGTAAGGCCTGG + Intergenic
1067147840 10:43706445-43706467 GTGGGGCAGGCTGTAAGGGCTGG + Intergenic
1070683473 10:78465208-78465230 ATGCTGAGGCCTGCAAGGGAGGG + Intergenic
1071337158 10:84610247-84610269 TTACTGAATGCTGAAAGGGCAGG + Intergenic
1071789262 10:88937140-88937162 ATGCTGAAGTCTTTTAGGGCAGG + Intronic
1073058937 10:100721630-100721652 ATGCAGACGCCTGTAGGGGCAGG - Intergenic
1075343866 10:121668223-121668245 TTGCTGAAAGCTGTGATGGCAGG - Intergenic
1075795718 10:125118192-125118214 AAGCTGAAAGCTGAAAGAGCAGG - Intronic
1076257233 10:129037292-129037314 TTGCTGAGGGCTGGAAGTGCTGG - Intergenic
1076284863 10:129284846-129284868 TTGCTGGAGGCGGTAAGGGGTGG + Intergenic
1076391299 10:130104840-130104862 ATGCTGTGGGCTGTCAGGGAAGG - Intergenic
1076744024 10:132503855-132503877 AGGCTGAGGGCTGGCAGGGCTGG - Intergenic
1077384762 11:2263623-2263645 ACCCTGAAGGCTGGGAGGGCAGG - Intergenic
1077564116 11:3285566-3285588 GTGCTGAAGTCTGGAAGGTCTGG + Intergenic
1077570006 11:3331383-3331405 GTGCTGAAGTCTGGAAGGTCTGG + Intergenic
1078147947 11:8734984-8735006 ATCCTGAACGCTGTCGGGGCAGG + Intronic
1078532608 11:12148688-12148710 AAGCTGAAGGCTGCAAGCCCCGG - Intronic
1079820879 11:25126470-25126492 ATGCTGAAGGCTAGAAGTTCAGG + Intergenic
1082776026 11:57245048-57245070 CTCCTGAAGGCTGGCAGGGCTGG - Intergenic
1083299174 11:61731263-61731285 AGGCTGTAGGCAGGAAGGGCAGG + Intronic
1083301323 11:61740930-61740952 AGGCTGAAGGCAGGTAGGGCAGG + Intronic
1085147351 11:74213123-74213145 ATGGTGAATGCTGTCAGGCCTGG - Intronic
1089731213 11:120520285-120520307 CTGCTGATGGCTGGACGGGCTGG - Intronic
1091195556 11:133727876-133727898 TTGCTGAAGGCTGTTGTGGCTGG - Intergenic
1092441576 12:8509306-8509328 AGCCTGAAGGCAGTAGGGGCGGG + Intergenic
1093477645 12:19573524-19573546 AATCTGAAGGCAGCAAGGGCAGG + Intronic
1097614702 12:61870138-61870160 ATTTGGAAGGCTGTAAGGACTGG + Intronic
1101069013 12:101053481-101053503 ATTCTGAGGGCTGTGAGGGAAGG + Intronic
1101742204 12:107509491-107509513 AGCCTGAAGCCTGTGAGGGCAGG - Intronic
1104406103 12:128518123-128518145 ATGCTGAAGGCTCTAGGGCTCGG + Intronic
1104608213 12:130205306-130205328 AGGCTTCAGGCTGTCAGGGCCGG - Intergenic
1106951610 13:34890719-34890741 CTTCTGAAGGCTGTGAGGGAAGG - Intergenic
1108781963 13:53847435-53847457 ATGTTGAAAGGTGGAAGGGCAGG - Intergenic
1108953548 13:56120972-56120994 ATGCTGAAGACTTTAGGGGAAGG - Intergenic
1109563845 13:64084693-64084715 TTTCTGAAGGGTGTAAGGTCTGG + Intergenic
1109914236 13:68959553-68959575 GTTCTGAAGGCTGTAACAGCTGG + Intergenic
1110522854 13:76501236-76501258 ATGCTGAAGTCTAAAAGGGAGGG + Intergenic
1110768779 13:79311308-79311330 ATGCTGAATGCTGGAAAAGCAGG + Intergenic
1112426947 13:99311275-99311297 AGGGGGAAGGCTGTGAGGGCGGG + Intronic
1113286231 13:108851996-108852018 ATGGTGAGGGCTGTAAGGTCGGG - Intronic
1116583688 14:46674870-46674892 ATGATGAATGCTGTTAGGACTGG - Intergenic
1118075708 14:62296237-62296259 CTTCTGAGGGCTGGAAGGGCAGG - Intergenic
1118768705 14:68927578-68927600 AGGCTGAATGCTCTCAGGGCAGG + Intronic
1118848436 14:69565933-69565955 ATGCTGGAAGCAGTAAGGGTGGG + Intergenic
1122088077 14:99320735-99320757 CTGTTGAAGGCTGTCAGGGGAGG - Intergenic
1122248384 14:100420382-100420404 ATCCTGAAGGCTGTAAAAACAGG - Intronic
1126462676 15:48929832-48929854 ATGCTGGGGGCTGAATGGGCAGG - Intronic
1126589834 15:50327493-50327515 ATGGTGAATTCTTTAAGGGCAGG - Intronic
1127674231 15:61225612-61225634 AGGTTGAAGGCTTTTAGGGCCGG - Intronic
1127869299 15:63057355-63057377 ATGGTGAGTTCTGTAAGGGCAGG - Intronic
1128212300 15:65911122-65911144 ATGCTGGAAGCTGTCAGGGAAGG + Intronic
1129198866 15:73986768-73986790 AGGATGAAGGATGTAGGGGCAGG + Intronic
1129210680 15:74066144-74066166 AGGCTGTTGGCTGTCAGGGCGGG + Intergenic
1129403331 15:75299185-75299207 AGGCTGTTGGCTGTCAGGGCGGG - Intergenic
1132842443 16:1984595-1984617 CGGATGAAGGCTGTAAGGCCGGG - Intronic
1133172126 16:3988025-3988047 GTGCTGGAGGCTGTAAGGAGGGG + Intronic
1133627965 16:7589890-7589912 ATGCTGAAGGCTGTGTGTGCTGG + Intronic
1133691773 16:8222500-8222522 ATGTGGAAGGCTGAAAGCGCGGG - Intergenic
1134754455 16:16654357-16654379 TTGCTTAAGGCTGGAAGGGTTGG - Intergenic
1134991607 16:18704681-18704703 TTGCTTAAGGCTGGAAGGGTTGG + Intergenic
1135157654 16:20067216-20067238 ATGCTGGAGGCTGCCTGGGCTGG - Intronic
1135323782 16:21513277-21513299 AGGGTGAAGGGTGTAAGGGGTGG - Intergenic
1135867278 16:26115482-26115504 ATGGAGATGGCTGAAAGGGCGGG + Intronic
1136335265 16:29606542-29606564 AGGGTGAAGGGTGTAAGGGGTGG - Intergenic
1140332430 16:74070836-74070858 ATCCTGATGGCTCCAAGGGCAGG + Intergenic
1141605579 16:85151708-85151730 ATCCTGAAGGCTGGAAGGCATGG - Intergenic
1142035990 16:87862384-87862406 AGGGTGAAGGGTGTAAGGGGTGG - Intronic
1145211800 17:21018852-21018874 ACGCTGAAGGCTGTGAGGGCAGG + Intronic
1146069611 17:29668160-29668182 AGGCTGTAGGCAGCAAGGGCAGG - Intronic
1147171224 17:38620176-38620198 CTGTCGGAGGCTGTAAGGGCTGG + Intergenic
1147213759 17:38887272-38887294 ATTCTGCAGACTGTATGGGCAGG - Intronic
1150800465 17:68277864-68277886 AAACTGAAGGCTGTCATGGCTGG + Intronic
1152567482 17:81106732-81106754 TTGCTGCAGGCTGTAGGGACAGG - Exonic
1153359060 18:4173379-4173401 TTGCTGAAGGCTGAAAGGTGGGG + Intronic
1153535590 18:6098340-6098362 TTGCTGGAGGCTGGAAGGACTGG - Intronic
1157292295 18:46418780-46418802 ATGCTCTGGGCTGTGAGGGCAGG + Intronic
1158266721 18:55667051-55667073 ATGCTGCAGGCTGCAGGAGCCGG + Intergenic
1160373125 18:78390786-78390808 ACTCTGAAGGCTGCAAAGGCCGG - Intergenic
1160778571 19:867863-867885 ATGCTGAAGGATTTAAAGACAGG + Intronic
1162870017 19:13579348-13579370 ATGTTGATGGCTGGCAGGGCTGG - Intronic
1166784506 19:45359522-45359544 ATTCTGGAGGCTTTATGGGCCGG - Intronic
927884176 2:26708325-26708347 AGGCAGAAATCTGTAAGGGCTGG + Intronic
929862764 2:45693509-45693531 ATGGTGCAGGCCGGAAGGGCAGG + Intronic
930512630 2:52365052-52365074 ATGCTGAAAACTGTGAGGACAGG - Intergenic
936021308 2:108996991-108997013 AGGCTGACTGCTGTAAGGGTGGG + Intergenic
936175510 2:110216628-110216650 ATGTTGAAGGCAGTAAGTTCTGG - Intergenic
936815661 2:116457099-116457121 ATGCTGGAGACTGTGAGTGCAGG + Intergenic
937219844 2:120336369-120336391 AAGCTGGAGGCAGTAGGGGCTGG + Intergenic
937690132 2:124746196-124746218 AGGCTGAAGGATGTGAGGCCTGG - Intronic
937969477 2:127538112-127538134 ATGCAGCAGGCTGTGAGGGGAGG + Intronic
938403086 2:131010288-131010310 AAGCAGAAAGCTGTAAGGGCAGG + Intronic
939462820 2:142518729-142518751 AAGCTGAAGTGTGTATGGGCAGG - Intergenic
939673163 2:145038436-145038458 AGGCTGCAGGCTGTCAGGCCTGG - Intergenic
940581321 2:155584351-155584373 AGCCTGAAGGCAGTATGGGCAGG - Intergenic
943494933 2:188608440-188608462 ATGCTAATGGCTGTCATGGCAGG - Intergenic
946736155 2:222756602-222756624 ATGCTGGAGGCTGAAAGGGGAGG - Intergenic
947869167 2:233423267-233423289 ATGCTGAAGAGTGTAATTGCTGG + Intronic
948265292 2:236631670-236631692 AGGATGAAGGGTGCAAGGGCAGG + Intergenic
948409749 2:237749952-237749974 AACCTGAAGACTGGAAGGGCAGG + Intronic
948598044 2:239092999-239093021 ATGCCGAGGGCTGGCAGGGCTGG + Intronic
1169012364 20:2261165-2261187 GAGCAGAAGGCTGTAAGGCCGGG - Intergenic
1171953732 20:31443252-31443274 GTGCAGAAGGCAGTAAGGGAGGG - Intronic
1172893916 20:38286295-38286317 ATGTTGAGGGCTGTGAGGGGAGG + Intronic
1175129524 20:56779131-56779153 CTGCTGGAGGCGGTAAGGGCAGG + Intergenic
1175525302 20:59629513-59629535 CTTCTGAGGGCTGTGAGGGCAGG + Intronic
1177934566 21:27327803-27327825 CTTCTGAAGGCTGTGAGGGAAGG - Intergenic
1179094623 21:38301573-38301595 ATGCTGATGTTTGTAAGGTCCGG + Exonic
1179489206 21:41729344-41729366 AGACTGGTGGCTGTAAGGGCTGG - Intergenic
1180183555 21:46128613-46128635 CAGCTGAAGGCAGTCAGGGCAGG + Intronic
1180934334 22:19614666-19614688 AAGCTGAAGGCTGTGGGAGCCGG - Intergenic
1181029589 22:20143375-20143397 CTGCTGCAGGCTGTAGGAGCTGG - Exonic
1181421781 22:22804847-22804869 AGGCTGAAGGCTGGAAATGCAGG + Intronic
1181513665 22:23399943-23399965 CTGCTGCAGGCTGTAGGAGCTGG + Intergenic
1182431634 22:30302319-30302341 CTGCTGAACTCTGTGAGGGCAGG + Intronic
1182788970 22:32932868-32932890 CTGCTGAGGGCTATAAGGGAAGG + Intronic
1183193246 22:36335397-36335419 GTGCTGACGGCTGGCAGGGCTGG + Intronic
950790979 3:15471810-15471832 ATGTTGAAGGATGTATGGGTTGG - Intronic
952940446 3:38440131-38440153 AAGCTGAAGTCTGTCAGTGCAGG - Intergenic
955254373 3:57314977-57314999 ATGCTTGAGACTGTAAGTGCAGG + Intronic
956281513 3:67562027-67562049 ATGCAGAAGGGAGTAGGGGCAGG - Intronic
957621876 3:82604478-82604500 ATGATGAATGCTGTTAGGACTGG - Intergenic
964623988 3:158741342-158741364 ATGCTGAAGGCTCCAAGCCCTGG - Intronic
965322240 3:167264929-167264951 ATGATGAATGCTGTCAGGCCTGG + Intronic
966303953 3:178509857-178509879 CTTCTGAGGGCTGTAAGGGAAGG - Intronic
966508344 3:180732326-180732348 AGACTTAATGCTGTAAGGGCTGG - Intronic
966864424 3:184249332-184249354 ATCCGGAAGGCTCGAAGGGCAGG - Intronic
968027610 3:195455763-195455785 ATGGTGCAGGCTGTAATGTCTGG - Intergenic
968186707 3:196637774-196637796 AGGATGAAGTCTGTGAGGGCTGG + Intergenic
968951759 4:3698892-3698914 ATCCTGAAGTCTGTGAGGGAGGG + Intergenic
971689334 4:29812473-29812495 CTGCTGGAGGCTGTAGGGGAGGG + Intergenic
973215674 4:47666792-47666814 GTTCTGAAGGCTGGAAGTGCAGG - Intronic
973947833 4:55977986-55978008 ATGCTGAAGGCTGTAAGGGCAGG - Intronic
976339717 4:83933630-83933652 TTGCTGAAGGCTCTAGGGGAGGG + Intergenic
976728464 4:88239740-88239762 ATGCTGAAGGCTGCCAGGTCTGG + Intergenic
980844304 4:138305635-138305657 CTTCTGAAGGCTGTGAGGGGAGG + Intergenic
981803209 4:148682012-148682034 GTTCTGAAGGATGAAAGGGCAGG + Intergenic
983517665 4:168674520-168674542 AGGCAGAATGCTGTAAGGGAAGG + Intronic
988842619 5:35097714-35097736 ATGCTGAAGGCTGTGGGAACCGG + Intronic
988897619 5:35694754-35694776 TTGCAGAAGGCTGTAGGGGCTGG + Intronic
993040275 5:82806418-82806440 ATGCTGAAGGCTGAGTGGGGTGG - Intergenic
994567963 5:101477365-101477387 ATGCTCAAGGGTGCAATGGCTGG - Intergenic
995882958 5:116863183-116863205 ATGCTTAAGTGTGTAAGGGGTGG + Intergenic
996837889 5:127814162-127814184 ATGCAGACGGCAGTAAGGGCAGG + Intergenic
999620535 5:153468255-153468277 AGGCTAAAGGGGGTAAGGGCAGG - Intergenic
1001657338 5:173361791-173361813 CTTCTGAGGGCTGTGAGGGCAGG + Intergenic
1002350834 5:178582648-178582670 ATGCTGAGGGCTGGAGGGGAAGG - Intronic
1003087388 6:3070801-3070823 ATGAGTAAGGCTGTAAGGGTGGG + Intronic
1003238174 6:4317134-4317156 CTGCTGGAGGCTGTAAGGCAGGG + Intergenic
1003583003 6:7359487-7359509 AAGATGTAGGCTCTAAGGGCAGG + Intronic
1005173497 6:23015647-23015669 ATTCTGTAGGATGTAATGGCTGG + Intergenic
1005450711 6:25969165-25969187 ATGCTAAAGGCTATATGTGCAGG - Intronic
1008011812 6:46475850-46475872 ACCCTGAAAGCTGTGAGGGCAGG - Intronic
1012892149 6:104908515-104908537 ATGGTGAATGCTGTCAGGCCAGG - Intergenic
1013863337 6:114662219-114662241 CTTCTGAAGGCTGTGAGGGAAGG + Intergenic
1017051058 6:150393850-150393872 ATGCTGAAAGATACAAGGGCAGG - Intronic
1017594485 6:156014047-156014069 ATGCCGAGGGCTGTCAGCGCTGG - Intergenic
1022431644 7:30328812-30328834 ACGCCCAAGGCTGTCAGGGCAGG + Intronic
1022733995 7:33059044-33059066 ATGCTGAAAGCTGTCAGAGGTGG - Intronic
1024981221 7:55159139-55159161 ATGATGCAGGCTGGGAGGGCTGG - Intronic
1026103817 7:67405000-67405022 CTTCTGAAGGCTGTGAGGGAGGG + Intergenic
1026373244 7:69723131-69723153 ATGATGAAGGCAGTAAGAACGGG - Intronic
1027425130 7:78054450-78054472 ATGCTGAAGACTGGAGAGGCAGG + Intronic
1027678750 7:81191966-81191988 ATGCAGAAGGTTATAAGGTCGGG + Intronic
1031837674 7:126697859-126697881 ATACTCAAGGCTGCAATGGCTGG + Intronic
1034472946 7:151265365-151265387 CTTCTGAAGGCTGTGAGGGAGGG - Intronic
1034538257 7:151739391-151739413 GTGCTGAATGTTGTAAGGTCAGG + Intronic
1034827593 7:154280493-154280515 ATGCTGGTGGCTGTAGGGACTGG + Intronic
1035213330 7:157345421-157345443 ATGCAGGAGGCTGAAATGGCAGG - Intronic
1036419509 8:8582901-8582923 TTTCTGAAGGCTGGAGGGGCTGG - Intergenic
1038361497 8:26883889-26883911 AGGCTGAAGGCTTTAGGGGGAGG + Intergenic
1038718722 8:30014155-30014177 AAGCCGAGGGCTGCAAGGGCCGG - Intergenic
1039586334 8:38710469-38710491 GTGCTGAAAGCTGTAGGGGGTGG + Intergenic
1040501487 8:48008762-48008784 AGGCTGAAGGCTCTACGGGAGGG + Intronic
1046002329 8:108435970-108435992 ATCCTGAAGGCTTTAATAGCTGG - Intergenic
1050051065 9:1602126-1602148 AGGCTGGAGCCTGAAAGGGCAGG - Intergenic
1051038678 9:12779646-12779668 ATGCTGAAGGTAGTAAGTGGAGG + Intronic
1051328667 9:16000089-16000111 ATGCTGTAGGCTTTGGGGGCAGG + Intronic
1052476821 9:28971168-28971190 ATGATGAATGCTGTCAGGACTGG - Intergenic
1052985808 9:34486784-34486806 TTGCTGAGGGCTGGAAGGGATGG - Intronic
1055730940 9:79278828-79278850 ATTCTGATAGCTGTATGGGCAGG - Intergenic
1056191604 9:84189786-84189808 TTGCTGAAGGCTGGGATGGCTGG - Intergenic
1057250397 9:93496540-93496562 ATGCTCGAGGCTGGACGGGCTGG - Intronic
1059280099 9:113125499-113125521 ATGCTTAAGGATGAAAGAGCAGG - Intergenic
1059664748 9:116436052-116436074 ATGCTGAACCTTGTAAAGGCAGG + Intronic
1060209658 9:121701838-121701860 ATGTTGAAGGCTGGGAGGGCAGG + Intronic
1060215354 9:121735671-121735693 TTGCTGGTGGCTGTAAGGGAAGG + Intronic
1060265612 9:122110093-122110115 AGGCTGAAGCTTGGAAGGGCAGG - Intergenic
1061081359 9:128372529-128372551 ATGCTGAACGCTGTAGGGCACGG - Intronic
1061750945 9:132776616-132776638 ACGCTGCAGGATGGAAGGGCTGG + Intronic
1061936090 9:133858420-133858442 ATGCAGAAGGCTCTATGGGGAGG + Intronic
1062379326 9:136279601-136279623 TTCCTGAAGGCTGGATGGGCAGG - Intergenic
1062495646 9:136830379-136830401 GTGCTGAAGGCTGGGAGGGCAGG - Intronic
1062680886 9:137779483-137779505 AAGCTGAAGGCTGGAAGGCCCGG - Intronic
1062680906 9:137779560-137779582 AAGCTGAAGGCTGGAAGGCCCGG - Intronic
1186765120 X:12762930-12762952 CTTCTGAAGGCTGTGAGGGAAGG - Intergenic
1194223612 X:91227337-91227359 ATGATGAATGCTGTCAGGCCTGG - Intergenic
1195136175 X:101909202-101909224 ATGATGAACGCTGTAAGGATTGG - Intronic
1195355395 X:104034750-104034772 ATGCTGGGGCCTGTCAGGGCTGG - Intergenic
1196829192 X:119762944-119762966 TTGGTGAAGGCTGTCAGGGCAGG + Intergenic
1197724846 X:129769371-129769393 TTGCTGAAGGGTGAAAGAGCTGG - Exonic
1198960525 X:142177555-142177577 CTGCTGAGGGCTGTGAGGGCAGG + Intergenic
1199048124 X:143202248-143202270 ATGATGAATGCTGTCAGGACTGG + Intergenic
1199966463 X:152824639-152824661 ATGCAGAAGGCTGAATGGGATGG - Intergenic
1200560078 Y:4690719-4690741 ATGATGAATGCTGTCAGGCCTGG - Intergenic