ID: 973947834

View in Genome Browser
Species Human (GRCh38)
Location 4:55977990-55978012
Sequence CGCAATGCTGAAGGCTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973947834_973947841 30 Left 973947834 4:55977990-55978012 CCCTTACAGCCTTCAGCATTGCG 0: 1
1: 0
2: 0
3: 9
4: 175
Right 973947841 4:55978043-55978065 GGGGACAGTGGAGTAGTGAAAGG 0: 1
1: 0
2: 4
3: 22
4: 334
973947834_973947840 18 Left 973947834 4:55977990-55978012 CCCTTACAGCCTTCAGCATTGCG 0: 1
1: 0
2: 0
3: 9
4: 175
Right 973947840 4:55978031-55978053 TGTGTGTGTTTAGGGGACAGTGG 0: 1
1: 3
2: 9
3: 152
4: 1149
973947834_973947837 9 Left 973947834 4:55977990-55978012 CCCTTACAGCCTTCAGCATTGCG 0: 1
1: 0
2: 0
3: 9
4: 175
Right 973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG 0: 1
1: 7
2: 63
3: 318
4: 2193
973947834_973947839 11 Left 973947834 4:55977990-55978012 CCCTTACAGCCTTCAGCATTGCG 0: 1
1: 0
2: 0
3: 9
4: 175
Right 973947839 4:55978024-55978046 ATGTGCATGTGTGTGTTTAGGGG No data
973947834_973947838 10 Left 973947834 4:55977990-55978012 CCCTTACAGCCTTCAGCATTGCG 0: 1
1: 0
2: 0
3: 9
4: 175
Right 973947838 4:55978023-55978045 CATGTGCATGTGTGTGTTTAGGG 0: 1
1: 5
2: 30
3: 235
4: 1439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973947834 Original CRISPR CGCAATGCTGAAGGCTGTAA GGG (reversed) Intronic
901944888 1:12693726-12693748 CACAATTCTGCAGGCTGTACAGG - Intergenic
902091985 1:13910892-13910914 CACAATTCTGTAGGCTGTACAGG + Intergenic
905316559 1:37085256-37085278 AGCAATGCTGAGTGCTGGAAAGG - Intergenic
906793725 1:48680283-48680305 CACAATTCTGAAGGCTGCAAGGG + Intronic
909379403 1:74980883-74980905 TCCAAAGCTGAAAGCTGTAAAGG + Intergenic
910698631 1:90048636-90048658 AGAAATGCTGAGGGCTGGAAAGG + Intergenic
916255381 1:162781947-162781969 AGCAATGCTGAAAGCTGAATGGG - Exonic
916384727 1:164254719-164254741 CGCAATTCTACAGGCTGTAAAGG - Intergenic
918930915 1:190855871-190855893 CGCAGTTCTGCAGGCTGTACAGG - Intergenic
919177056 1:194032632-194032654 CACAATTTTGCAGGCTGTAAAGG + Intergenic
919179050 1:194058349-194058371 TGCAGTTCTGCAGGCTGTAAAGG + Intergenic
919349703 1:196433182-196433204 CACAATCCTGAAGGCTGTGAAGG - Intronic
922660538 1:227426263-227426285 CACAATTCTGCAGGCTGTAAAGG + Intergenic
923857217 1:237858079-237858101 CACAGTGCTGCAGGCTGTACAGG - Intergenic
923976681 1:239271823-239271845 CACAATTCTGCAGGCTGTACAGG - Intergenic
1065326575 10:24555107-24555129 CGCAAGGCTGAAGTCTGGGATGG - Intergenic
1067280871 10:44871680-44871702 GGCTATGATGAAGGCTGTCAAGG - Intergenic
1068549869 10:58394357-58394379 GGAAAAGCTGAAGACTGTAAAGG + Exonic
1069624647 10:69860298-69860320 TGCTGTGCAGAAGGCTGTAAAGG - Intronic
1071962908 10:90823950-90823972 CACAATTCTGAAGGCTCTACAGG - Intronic
1073744015 10:106445225-106445247 CGCAGTTCTGCAGGCTGTATGGG - Intergenic
1078684060 11:13510324-13510346 CGCAGTTCTGCAGGCTGTATAGG + Intergenic
1080502515 11:32884383-32884405 CACAGTTCTGCAGGCTGTAAAGG + Intergenic
1082628487 11:55513581-55513603 CACATTTCTGAAGGCTGTACAGG - Intergenic
1084075263 11:66770222-66770244 CACAATTCTGAAGGCTGGGAAGG - Intronic
1085563595 11:77492968-77492990 CGCAGTTCTGCAGGCTGTACAGG - Intergenic
1089669360 11:120042783-120042805 CGCAATTCTACAGGCTGTACAGG + Intergenic
1090176388 11:124653529-124653551 CGCAGTGCTGAATGCGGCAAAGG + Intronic
1091497904 12:988562-988584 CACAATTCTGCAGGCTGTACAGG + Intronic
1096518062 12:52169028-52169050 CACAATTCTGCAGGCTGTACTGG + Exonic
1099505389 12:83470043-83470065 TGCAGTGTTGAAGGCTGAAAGGG + Intergenic
1100123277 12:91393987-91394009 CACAATTCTGCAGGCTGTACAGG - Intergenic
1100743769 12:97623300-97623322 CGCAATTCTGAAGGCTGGGGTGG - Intergenic
1103759714 12:123239904-123239926 GGCAATGGTGAAGGCTGAGAAGG - Intronic
1104247423 12:127056975-127056997 CGCAATGCTCAATGCTGGGATGG + Intergenic
1105582322 13:21710534-21710556 CGCAGTTCTGCAGGCTGTACAGG + Intergenic
1108379620 13:49843630-49843652 CCCAATGCTCAAGTCTGTAAGGG + Intergenic
1108731082 13:53236445-53236467 CGCAGTTCTGCAGGCTGTACAGG - Intergenic
1109507753 13:63328739-63328761 CACAATTCTGCAGGCTGTATAGG - Intergenic
1111715092 13:91869728-91869750 CACAATTCTGCAGGCTGTACAGG + Intronic
1111907418 13:94271523-94271545 CCCAAGGCTCAAGGTTGTAAAGG - Intronic
1114935853 14:27535184-27535206 CACAATTCTGCAGGCTGTACAGG - Intergenic
1123770765 15:23526068-23526090 CGCAGTTCTGCAGGCTGTACAGG - Intergenic
1124885165 15:33678471-33678493 CACAATTCTGCAGGCTGTACAGG - Intronic
1126225360 15:46262885-46262907 CCCAAAGCCCAAGGCTGTAATGG + Intergenic
1126541634 15:49830652-49830674 AGCACTGCTGAAGACTGTCATGG - Intergenic
1127885658 15:63197823-63197845 AGCAAGGCTGAGGGCTGTGATGG + Intronic
1130664312 15:85856667-85856689 CACAGTGCTGCAGGCTGTACAGG - Intergenic
1131939707 15:97547488-97547510 CACGATGCTGCAGGCTGTACAGG + Intergenic
1132210525 15:100018640-100018662 CACAATTCTGCAGGCTGTACAGG - Intronic
1134332466 16:13263586-13263608 CACAATTCTGCAGGCTGTACAGG - Intergenic
1138114551 16:54350113-54350135 CACAATCCTGCAGGCTGTACAGG - Intergenic
1138769272 16:59643697-59643719 CACAGTTCTGAAGGCTGTACAGG - Intergenic
1144704469 17:17358180-17358202 CACTATGCTGAAGGCCTTAAAGG + Intergenic
1149062964 17:52445803-52445825 CACAGTTCTGCAGGCTGTAAAGG - Intergenic
1149144098 17:53468967-53468989 AGCATTTATGAAGGCTGTAAGGG - Intergenic
1150933529 17:69611021-69611043 CACAATTCTGCAGGCTGTACAGG - Intergenic
1155359728 18:24988067-24988089 CGCAATTCTGAAGGCAGCACAGG - Intergenic
1155594579 18:27470216-27470238 TGCAGGGCTGAAGGCTGTGATGG - Intergenic
1156632267 18:38984377-38984399 CACAATTCTGCAGGCTGTACAGG - Intergenic
1156910385 18:42405109-42405131 CGCAATGATGAAAACTGAAATGG - Intergenic
1166581666 19:43905801-43905823 CACAGTGCTGCAGGCTGTACAGG - Intergenic
1167725034 19:51205669-51205691 CACAGTTCTGCAGGCTGTAAGGG - Intergenic
1168173389 19:54606300-54606322 GGCAAGGCTGAAAGCTGTGATGG - Intronic
925763831 2:7211886-7211908 CCCAGTCCTGAAGGCTGTACAGG - Intergenic
927260530 2:21083930-21083952 CACAGTACTGAAGGCTGTCATGG + Intergenic
928186403 2:29115211-29115233 CGCGAGGCTGAGGGCTGTGAAGG + Intronic
929814097 2:45217622-45217644 CGCAGTTCTGCAGGCTGTACGGG - Intergenic
930553895 2:52870695-52870717 CACAATTCTGCAGGCTGTACAGG - Intergenic
933614602 2:84470869-84470891 CGCAATTGTGGAGGCTGCAAAGG + Intergenic
934844456 2:97653685-97653707 CCCAATGCTCAAATCTGTAACGG - Intergenic
935329791 2:101968590-101968612 CGCAGTTCTGCAGGCTGTATAGG + Intergenic
935435874 2:103031594-103031616 CAGAATTCTGGAGGCTGTAAAGG - Intergenic
936144678 2:109972542-109972564 CGCAATCATGGAGGCTGCAAAGG + Intergenic
936181363 2:110270505-110270527 CGCAATCATGGAGGCTGCAAAGG + Intergenic
936200009 2:110398927-110398949 CGCAATCATGGAGGCTGCAAAGG - Intergenic
938118198 2:128616312-128616334 CACAATTCTGCAGGCTGTACAGG - Intergenic
939269674 2:139921368-139921390 CACAATTCTGCAGGCTGTACAGG - Intergenic
940274195 2:151921932-151921954 CACAGTTCTGAAGGCTGTACAGG - Intronic
941738511 2:169007453-169007475 CACAATTCTGCAGGCTGTACAGG + Intronic
943612103 2:190045566-190045588 CCAAATCCTGAAGGCTGGAATGG + Intronic
944331269 2:198469252-198469274 CACAGTTCTGCAGGCTGTAAAGG + Intronic
944440511 2:199738787-199738809 AGCAAAGGTGAAGACTGTAAGGG + Intergenic
944500524 2:200354666-200354688 CGCAATGGTGAGGGCTTGAAAGG - Intronic
945375418 2:209074219-209074241 AGCATTGCTCATGGCTGTAATGG - Intergenic
945529635 2:210935423-210935445 CACAGTTCTGAAGGCTGTACAGG + Intergenic
948091220 2:235297527-235297549 CACAGTTCTGCAGGCTGTAAAGG + Intergenic
1170357770 20:15510771-15510793 TGCACCGCTGGAGGCTGTAACGG + Intronic
1171369058 20:24648788-24648810 CCCAATGCTGACTGCTGAAATGG - Intronic
1172250556 20:33476223-33476245 GGAAGTGCTGAAGGCTGAAAGGG - Intergenic
1172870077 20:38130251-38130273 CGACAAGCTGAAGGCTGTGAAGG - Exonic
1176613684 21:9009676-9009698 CCCAATTCTGCAGGCTGTACAGG - Intergenic
1179143968 21:38751596-38751618 CGCAGTTCTGCAGGCTGTACGGG - Intergenic
1182916611 22:34038869-34038891 CGCACTGTTGAAGGCTGTGATGG + Intergenic
1184266359 22:43348849-43348871 CACAATTCTGCAGGCTGTACAGG - Intergenic
1184827552 22:46963370-46963392 CGCAGTGCCCAAGGCTGGAAAGG + Intronic
949703049 3:6781225-6781247 GACAATGCTGAATGTTGTAAGGG + Intronic
950310945 3:11957178-11957200 CACAATTCTGCAGGCTGTACAGG - Intergenic
951087534 3:18531201-18531223 CACAATTCTGCAGGCTGTACAGG - Intergenic
953091963 3:39736863-39736885 CACAGTTCTGCAGGCTGTAAAGG - Intergenic
953144144 3:40258331-40258353 CGCAGTGCTGAAGTCTGAGACGG - Exonic
955031754 3:55228697-55228719 GGCAAAGGTGAAGGCTATAATGG + Intergenic
956905276 3:73759046-73759068 CACAATTCTGCAGGCTGTACAGG - Intergenic
958834578 3:99129899-99129921 CACAATTCTGCAGGCTGTATAGG + Intergenic
959171219 3:102846993-102847015 CACAATTCTGCAGGCTGTACAGG + Intergenic
959349909 3:105249182-105249204 CGCAGTTCTGCAGGCTGTACAGG - Intergenic
959471472 3:106757178-106757200 CACAGTTCTGCAGGCTGTAAAGG + Intergenic
960027313 3:113023826-113023848 CACAATTCTGCAGGCTGTACAGG - Intergenic
960887171 3:122407756-122407778 CACCATGCTGAAGGCAGTTATGG - Intronic
964255789 3:154772927-154772949 CCAAAGGCTGAAGGCTGGAATGG + Intergenic
965585577 3:170314889-170314911 CACAAACCTGAAGGCTATAAAGG - Intergenic
969333200 4:6491861-6491883 CACAATTCTGCAGGCTGTACAGG - Intronic
970237836 4:13976578-13976600 CACAATTCTGTAGGCTGTACAGG + Intergenic
970312831 4:14800144-14800166 CACAATTCTGTAGGCTGTACAGG + Intergenic
972937265 4:44152325-44152347 TCAATTGCTGAAGGCTGTAATGG + Intergenic
973947834 4:55977990-55978012 CGCAATGCTGAAGGCTGTAAGGG - Intronic
975417521 4:74122251-74122273 CACAATTCTGCAGGCTGTACAGG + Intronic
978238877 4:106492142-106492164 CCAAATCCTGAAGGCTGGAATGG + Intergenic
978322829 4:107516684-107516706 CACAATTCTGCAGGCTGTACAGG - Intergenic
979775097 4:124580891-124580913 CTCAATTCTGTAGGCTGTACAGG + Intergenic
981335854 4:143568233-143568255 CACAATTCTGCAGGCTGTACAGG - Intergenic
982523930 4:156453868-156453890 CACAATTCTGTAGGCTGTAAAGG - Intergenic
982805139 4:159754193-159754215 CACAGTTCTGGAGGCTGTAAAGG - Intergenic
983015687 4:162608965-162608987 CCCAGTTCTGAAGGCTGTACAGG - Intergenic
986158367 5:5199528-5199550 TGCACTGCTGGAGGCTGTGATGG - Intronic
986627359 5:9734983-9735005 CACAATTCTGTAGGCTGTACAGG + Intergenic
987542936 5:19277989-19278011 CGCAGTTCTGCAGGCTGTACTGG - Intergenic
988189523 5:27910379-27910401 CACAGTTCTGCAGGCTGTAAAGG - Intergenic
988297477 5:29384152-29384174 CTCAGTTCTGCAGGCTGTAAAGG - Intergenic
994080755 5:95706498-95706520 CACAATTCTGCAGGCTGTACAGG - Intergenic
994081640 5:95713571-95713593 CACAATTCTGCAGGCTGTACAGG - Intronic
995333636 5:110974521-110974543 CAAAATTCTGAAGCCTGTAATGG - Intergenic
996828150 5:127708980-127709002 CGCAGTTCTGCAGGCTGTACGGG + Intergenic
998294360 5:140952797-140952819 CGCAGTTCTGCAGGCTGTACAGG + Intronic
1007383973 6:41508237-41508259 TGCCATGCTGAAGGCTGTCAGGG + Intergenic
1007972316 6:46065267-46065289 GGCAATGCTGAATCCTGGAAAGG + Intronic
1010584311 6:77639571-77639593 TACAATGCTGATGGCTTTAATGG + Intergenic
1012009303 6:93760820-93760842 CTAAATGCTGAAGGCAGTTAAGG + Intergenic
1014073605 6:117211786-117211808 CGCAGTTCTGCAGGCTGTACAGG + Intergenic
1015126552 6:129761580-129761602 AGCATTGCAGAAGGCTGTGAAGG - Intergenic
1015968077 6:138715181-138715203 CACAATTCTGCAGGCTGTACGGG + Intergenic
1016770322 6:147842328-147842350 CACAATGCTGAGGGTTGTGATGG - Intergenic
1017938214 6:159025936-159025958 CACAATTCTGCAGGCTGTACAGG + Intergenic
1019342635 7:515837-515859 TGCAATGCTAAAGGCGATAATGG + Intronic
1020159589 7:5759236-5759258 CACAATTCTGTAGGCTGTATAGG - Intronic
1020705392 7:11537643-11537665 CGCAGTCCTGCAGGCTGTACAGG - Intronic
1024145862 7:46515682-46515704 CACAATTCTGCAGGCTGTACAGG - Intergenic
1031261908 7:119532185-119532207 CACAGTTCTGTAGGCTGTAAAGG - Intergenic
1032122606 7:129168073-129168095 CACAATGCTGAGGGCTGGGATGG - Exonic
1032896804 7:136260654-136260676 CGCAATTGTGGAGGCTGTGAAGG + Intergenic
1037165863 8:15827834-15827856 CGGAATGTTGAAGGCTGTTTGGG + Intergenic
1041705273 8:60840270-60840292 CACAAGGCTGAAAGATGTAAAGG - Intronic
1042404879 8:68393047-68393069 GGAAATGCTGAAGACTGAAATGG + Intronic
1043546445 8:81320905-81320927 CGCAGTTCTGCAGGCTGTACGGG - Intergenic
1043704867 8:83335516-83335538 CACAATTCTGCAGGCTGTACAGG - Intergenic
1043894114 8:85723892-85723914 CACAATGTTGAATGCTTTAAAGG - Intergenic
1046027269 8:108739922-108739944 CGCAATCGTGGAGGCTGTGAAGG + Intronic
1048307342 8:133293394-133293416 CGCAATGTTGGAGGGTGGAAAGG + Intronic
1048319140 8:133385167-133385189 TGAAATGCTGATGGCTGGAATGG - Intergenic
1048954029 8:139519369-139519391 GACAATGCTGGAGGCTGGAAAGG - Intergenic
1049001440 8:139827792-139827814 CACAGTGCTGCAGGCTGTACAGG + Intronic
1049005507 8:139853119-139853141 CTCCATGCTGAATTCTGTAAAGG + Intronic
1052660485 9:31422777-31422799 CACAATTCTGGAGGCTGTAAAGG + Intergenic
1052799262 9:32952551-32952573 CCCAGTTCTGCAGGCTGTAAAGG + Intergenic
1053666082 9:40318525-40318547 CACAGTTCTGCAGGCTGTAAAGG - Intronic
1055367618 9:75562203-75562225 CACAATGCTGCACGCTGTACAGG + Intergenic
1057161496 9:92891821-92891843 CACAGTTCTGCAGGCTGTAAAGG + Intergenic
1057677793 9:97149398-97149420 CACAGTTCTGCAGGCTGTAAAGG + Intergenic
1057983223 9:99682916-99682938 CACAATTCTGCAGGCTATAAAGG + Intergenic
1058182088 9:101810415-101810437 CACAATTCTGCAGGCTGTACAGG - Intergenic
1060159925 9:121352773-121352795 AGAAATGCTGAAGGCAGTCAAGG + Intronic
1060502352 9:124170534-124170556 CACAGTGCTGCAGGCTGTACAGG + Intergenic
1193667431 X:84338996-84339018 CACAGTTCTGCAGGCTGTAAAGG - Intronic
1194819148 X:98484659-98484681 CACAATTCTGTAGGCTGTACAGG - Intergenic
1194961653 X:100243276-100243298 CACAGTTCTGAAGGCTGTACAGG + Intergenic
1195104766 X:101593425-101593447 CTTAAGGCTGAAGGCTGGAATGG + Intergenic
1195520199 X:105821680-105821702 CGGAACGCTGGAGGCTGGAAGGG + Intergenic
1196013890 X:110916950-110916972 CACAGTTCTGAAGGCTGTACAGG - Intergenic
1196823702 X:119724298-119724320 CACAATTCTGCAGGCTGTACAGG + Intergenic
1197162275 X:123337455-123337477 CCCAATGCTGAACTCTGAAAGGG - Intronic
1199073568 X:143505715-143505737 CACAATTCTGTAGGCTGTACGGG - Intergenic
1199603462 X:149557570-149557592 CGCATTTCTGCAGGCTGTACAGG - Intergenic
1199646925 X:149921905-149921927 CGCATTTCTGCAGGCTGTACAGG + Intergenic
1201165304 Y:11203839-11203861 CTCAATGCTGAGAACTGTAATGG + Intergenic
1201254296 Y:12091789-12091811 CACAATTCTGCAGGCTGTACAGG - Intergenic