ID: 973947835

View in Genome Browser
Species Human (GRCh38)
Location 4:55977991-55978013
Sequence GCGCAATGCTGAAGGCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973947835_973947839 10 Left 973947835 4:55977991-55978013 CCTTACAGCCTTCAGCATTGCGC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 973947839 4:55978024-55978046 ATGTGCATGTGTGTGTTTAGGGG No data
973947835_973947841 29 Left 973947835 4:55977991-55978013 CCTTACAGCCTTCAGCATTGCGC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 973947841 4:55978043-55978065 GGGGACAGTGGAGTAGTGAAAGG 0: 1
1: 0
2: 4
3: 22
4: 334
973947835_973947840 17 Left 973947835 4:55977991-55978013 CCTTACAGCCTTCAGCATTGCGC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 973947840 4:55978031-55978053 TGTGTGTGTTTAGGGGACAGTGG 0: 1
1: 3
2: 9
3: 152
4: 1149
973947835_973947842 30 Left 973947835 4:55977991-55978013 CCTTACAGCCTTCAGCATTGCGC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 973947842 4:55978044-55978066 GGGACAGTGGAGTAGTGAAAGGG 0: 1
1: 0
2: 2
3: 24
4: 260
973947835_973947838 9 Left 973947835 4:55977991-55978013 CCTTACAGCCTTCAGCATTGCGC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 973947838 4:55978023-55978045 CATGTGCATGTGTGTGTTTAGGG 0: 1
1: 5
2: 30
3: 235
4: 1439
973947835_973947837 8 Left 973947835 4:55977991-55978013 CCTTACAGCCTTCAGCATTGCGC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG 0: 1
1: 7
2: 63
3: 318
4: 2193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973947835 Original CRISPR GCGCAATGCTGAAGGCTGTA AGG (reversed) Intronic
906793724 1:48680282-48680304 GCACAATTCTGAAGGCTGCAAGG + Intronic
913277493 1:117153355-117153377 CCGGCATGCTGAAGGCTGCAGGG + Exonic
916255382 1:162781948-162781970 GAGCAATGCTGAAAGCTGAATGG - Exonic
916688607 1:167170281-167170303 GAGCAAACCTGAAGCCTGTAAGG + Intergenic
919819109 1:201461822-201461844 GTGCAATCCTGAAGTCTGTTGGG - Intergenic
1066656421 10:37702596-37702618 TCACAATTCTGAAGGCTGGAGGG + Intergenic
1072574345 10:96686637-96686659 GCACAATGCTGAGGGCTGACTGG - Intronic
1073744016 10:106445226-106445248 TCGCAGTTCTGCAGGCTGTATGG - Intergenic
1076874628 10:133209974-133209996 GCGCAATGCTGCACGCTCAAAGG - Intronic
1076881126 10:133239716-133239738 GCTCCATGGTGAAGGCTGTGCGG - Exonic
1077412467 11:2410063-2410085 GGGCAGTGCTGGAGGCCGTATGG + Intronic
1077745991 11:4906688-4906710 GGGTACTGCTGAAGACTGTATGG + Intronic
1087806058 11:102556821-102556843 GCTCATCCCTGAAGGCTGTATGG + Intergenic
1093202991 12:16212073-16212095 ATGAAATGCTGAAGGATGTAGGG + Intronic
1108379618 13:49843629-49843651 GCCCAATGCTCAAGTCTGTAAGG + Intergenic
1109170628 13:59092898-59092920 ACGCATTGCTGAAGGGTCTAGGG + Intergenic
1121570379 14:94942571-94942593 GCGCCATGCTGAAGTCTCAAGGG - Intergenic
1121979577 14:98442879-98442901 GCTCAATGCTGAGGGCTCTTTGG + Intergenic
1122170860 14:99873862-99873884 GCGCTATGCTGAGTGCTGGAGGG - Intronic
1125518029 15:40333822-40333844 GCTCTCTGCTGAAGGCTGTGGGG - Exonic
1128394973 15:67215254-67215276 GCACTATGCTGGAGGCTGTGCGG - Intronic
1129468314 15:75736691-75736713 GCTCAATGCTGCAGGCCGTAGGG - Intergenic
1129727262 15:77907810-77907832 GCTCAATGCTGTAGGTAGTAGGG + Intergenic
1129840618 15:78741209-78741231 GCTCAATGCTGCAGGCCATAGGG - Intergenic
1133154250 16:3861344-3861366 GCTCAGTGCTAAATGCTGTATGG - Intronic
1134609892 16:15599481-15599503 CAGCACTGCTGAAGGCTGTGGGG + Intronic
1135720992 16:24818143-24818165 GCGTAATGGAGAAGGCTGAAGGG + Intronic
1135918396 16:26626165-26626187 GGGCAGGGCTGAAGTCTGTAGGG + Intergenic
1137621853 16:49881431-49881453 GCCCAATGCTCATGGCTGCAGGG + Intergenic
1138680397 16:58679889-58679911 CCGCAGTGCTGAAGGCTGCTGGG + Exonic
1140210958 16:72969866-72969888 GAGCAATCCTGAAGGCTGCTGGG - Intronic
1143459032 17:7088619-7088641 GTGCACTGCGGAAGGCTGCAGGG + Intergenic
1148873622 17:50673507-50673529 GCACAATGATGAAGTCTGTCTGG - Exonic
1151060056 17:71081235-71081257 GCGAAATGCAGAAGGTTTTATGG - Intergenic
1155244835 18:23897457-23897479 GCAGAATGGTGAAGGCTGCAGGG - Intronic
1156449781 18:37260528-37260550 GCTCAACAGTGAAGGCTGTAAGG + Intronic
1161470950 19:4456580-4456602 GTGCAAGGCTGAGGGCTGTTGGG - Intronic
1162649210 19:12073109-12073131 ATGAAATGCTGAAGGCTGAATGG - Intronic
1164850784 19:31482459-31482481 TCACAATTCTGCAGGCTGTATGG + Intergenic
1167279804 19:48560286-48560308 GCCCTGTGCTGAAGGCTGTGTGG + Intronic
927384395 2:22516237-22516259 TCACAATTCTGAAGGCTGGAGGG - Intergenic
927580154 2:24236324-24236346 GCTCAGGGCTGAAGGCTGGAGGG + Intronic
929814098 2:45217623-45217645 TCGCAGTTCTGCAGGCTGTACGG - Intergenic
932843486 2:75109092-75109114 CTGCAGTGCTGAAGGCTGCAGGG + Intronic
937581344 2:123492572-123492594 GCTCAATTCTGAAGGTTGTAAGG + Intergenic
940829331 2:158450471-158450493 GCACAAAGCTGCTGGCTGTATGG + Intronic
941570046 2:167159187-167159209 GTGCACTGCAGAAGGCTGTCAGG + Intronic
943969778 2:194389267-194389289 GCAAAATGCTCAAGGCAGTAAGG + Intergenic
944198933 2:197084844-197084866 GCCCAAAGATAAAGGCTGTAAGG + Intronic
944659771 2:201911650-201911672 GCTCCATTTTGAAGGCTGTAGGG - Intergenic
946716985 2:222563218-222563240 GCCAAATGGTTAAGGCTGTAGGG + Intergenic
1176204201 20:63879267-63879289 GAGCAATGCTGAGGGCTGTGGGG + Intronic
1179143969 21:38751597-38751619 TCGCAGTTCTGCAGGCTGTACGG - Intergenic
1179272506 21:39862272-39862294 GCCCAATTCTGAAAGCTGTCAGG + Intergenic
949871264 3:8591363-8591385 GCCCAGTGCTGAAAACTGTAAGG - Intergenic
950461525 3:13125057-13125079 GCGCACTGCTGCAGGCAGAAGGG - Intergenic
953188491 3:40661164-40661186 GCCCACTGCTGAAGGCAGTGGGG - Intergenic
955433370 3:58872820-58872842 GAGCTATGCTGGATGCTGTAAGG + Intronic
957744442 3:84320820-84320842 GTACAATGCTGAAGGCTGGGTGG + Intergenic
967490938 3:190090079-190090101 GAGCAATTCTGAAGGCTGGCAGG - Intronic
973750563 4:54015592-54015614 TCTGAATGCTGAAGGCTGTAGGG + Intronic
973947835 4:55977991-55978013 GCGCAATGCTGAAGGCTGTAAGG - Intronic
994029750 5:95128103-95128125 GCAAAATGCTAAAGGCTGGAAGG + Intronic
996828149 5:127708979-127709001 TCGCAGTTCTGCAGGCTGTACGG + Intergenic
997462009 5:134059162-134059184 GCTCCAGGCTGAGGGCTGTAAGG + Intergenic
1001547870 5:172581642-172581664 GGGCAGTGCTGGAGGCTGGAGGG - Intergenic
1005727821 6:28666701-28666723 GCGACATGCTGTAGGCTATATGG + Intergenic
1007383972 6:41508236-41508258 ATGCCATGCTGAAGGCTGTCAGG + Intergenic
1015968076 6:138715180-138715202 TCACAATTCTGCAGGCTGTACGG + Intergenic
1018794147 6:167172730-167172752 GAGCAAGGCTGGAGGCTCTACGG + Intronic
1018807129 6:167270375-167270397 GTGCAATGCGGAGGGCTGTGGGG + Intergenic
1018822175 6:167382288-167382310 GAGCAAGGCTGGAGGCTCTACGG - Intronic
1019230736 6:170559905-170559927 GCGTAATTCTTAAGGCTCTATGG - Intronic
1022495826 7:30852516-30852538 GTGCAGAGCTGAAGTCTGTATGG + Intronic
1024551250 7:50564256-50564278 GAGCAAGGCTGAATGCTGGAGGG + Intronic
1032781784 7:135170021-135170043 GCGCAATGCTGCAGTCTGTGCGG + Intronic
1033713839 7:143979081-143979103 GCACAATGCTTAAAGGTGTAAGG - Intergenic
1034829621 7:154298138-154298160 GCTCAAGCCTGAAGGCTGTCTGG - Intronic
1037165862 8:15827833-15827855 CCGGAATGTTGAAGGCTGTTTGG + Intergenic
1039977639 8:42381003-42381025 GCACAATGCTGGTGGCAGTATGG + Intergenic
1043546446 8:81320906-81320928 TCGCAGTTCTGCAGGCTGTACGG - Intergenic
1044645371 8:94436906-94436928 GAGCAGAGCTGAAGGCTGCATGG - Exonic
1048398260 8:134036035-134036057 GGGCAATGCTAAAGGCAGAATGG + Intergenic
1056771873 9:89483391-89483413 GCACTGTGCTGAAGGCTCTAAGG + Intronic
1061061466 9:128252639-128252661 GCTCAATGCTGTGGGCAGTAGGG + Intronic
1061081360 9:128372534-128372556 CAGAAATGCTGAACGCTGTAGGG - Intronic
1061936087 9:133858415-133858437 GCACTATGCAGAAGGCTCTATGG + Intronic
1189533253 X:41908848-41908870 GAGAAATGGTTAAGGCTGTATGG + Intronic
1192522683 X:71815719-71815741 GCTCAATGCTAAGGGCTGTGAGG - Intergenic
1197162277 X:123337456-123337478 GCCCAATGCTGAACTCTGAAAGG - Intronic
1197925410 X:131642181-131642203 TCATAATTCTGAAGGCTGTAAGG + Intergenic
1199073569 X:143505716-143505738 TCACAATTCTGTAGGCTGTACGG - Intergenic
1200279454 X:154763797-154763819 GCGGAATGCTGTAGGCAGTTGGG + Intronic
1201977813 Y:19871366-19871388 GGGGGATGCTGAAGGCTGAATGG + Intergenic