ID: 973947836

View in Genome Browser
Species Human (GRCh38)
Location 4:55977999-55978021
Sequence ACACACATGCGCAATGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973947836_973947839 2 Left 973947836 4:55977999-55978021 CCTTCAGCATTGCGCATGTGTGT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 973947839 4:55978024-55978046 ATGTGCATGTGTGTGTTTAGGGG No data
973947836_973947842 22 Left 973947836 4:55977999-55978021 CCTTCAGCATTGCGCATGTGTGT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 973947842 4:55978044-55978066 GGGACAGTGGAGTAGTGAAAGGG 0: 1
1: 0
2: 2
3: 24
4: 260
973947836_973947841 21 Left 973947836 4:55977999-55978021 CCTTCAGCATTGCGCATGTGTGT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 973947841 4:55978043-55978065 GGGGACAGTGGAGTAGTGAAAGG 0: 1
1: 0
2: 4
3: 22
4: 334
973947836_973947840 9 Left 973947836 4:55977999-55978021 CCTTCAGCATTGCGCATGTGTGT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 973947840 4:55978031-55978053 TGTGTGTGTTTAGGGGACAGTGG 0: 1
1: 3
2: 9
3: 152
4: 1149
973947836_973947838 1 Left 973947836 4:55977999-55978021 CCTTCAGCATTGCGCATGTGTGT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 973947838 4:55978023-55978045 CATGTGCATGTGTGTGTTTAGGG 0: 1
1: 5
2: 30
3: 235
4: 1439
973947836_973947837 0 Left 973947836 4:55977999-55978021 CCTTCAGCATTGCGCATGTGTGT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG 0: 1
1: 7
2: 63
3: 318
4: 2193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973947836 Original CRISPR ACACACATGCGCAATGCTGA AGG (reversed) Intronic
900600430 1:3500438-3500460 ACGCACATGCGCACTGCGGCTGG - Intronic
901002946 1:6157708-6157730 ACACACATGGCCATTCCTGATGG + Intronic
902857654 1:19220736-19220758 ACCCTCATGGGCAGTGCTGAAGG - Intronic
903378829 1:22883237-22883259 ACACACATGGCCTCTGCTGAGGG - Intronic
905940961 1:41862981-41863003 ACACACAAGAGCAATGCTTAAGG + Intronic
908186230 1:61655361-61655383 ACACAGATGCCCCTTGCTGAGGG + Intergenic
919373094 1:196755887-196755909 ACACACTTGCACATTGTTGATGG + Intergenic
919379539 1:196840570-196840592 ACACACTTGCACATTGTTGATGG + Intronic
919824672 1:201494813-201494835 ACACACACGCACACTGCTGAGGG - Intronic
1069729240 10:70600465-70600487 AGACACATGCACATTGCTGGTGG + Exonic
1072457587 10:95590271-95590293 ATACACATGAGCAATTCAGAGGG + Intergenic
1073841380 10:107502822-107502844 TCTCACATGCACAATACTGAAGG - Intergenic
1074762066 10:116674672-116674694 ATTCACATGGGCAATGGTGAGGG + Exonic
1074827007 10:117221932-117221954 AGACACACAGGCAATGCTGACGG - Intergenic
1081788667 11:45767224-45767246 ACACAGATGGGCAATGCATAGGG + Intergenic
1083336695 11:61926280-61926302 ACACACATGCCAAGTGCTGATGG + Intergenic
1085903011 11:80724385-80724407 ACACACACGTGGAATGCTGTAGG - Intergenic
1086607656 11:88715638-88715660 ACACAAATAAGTAATGCTGACGG + Intronic
1087745103 11:101935011-101935033 ACTCACATGCACAATGCTGGAGG - Intronic
1088135100 11:106546337-106546359 ACACACATGCACAGTTCAGATGG + Intergenic
1091722930 12:2826448-2826470 ACACACACACGCAAGGCTCAGGG + Exonic
1092137628 12:6160778-6160800 ACACCCAAGTGAAATGCTGAGGG + Intergenic
1094354807 12:29566151-29566173 ACACATATGAGGAGTGCTGAAGG + Intronic
1094852711 12:34389401-34389423 CCACACATGCGCGAGGCCGAGGG + Intergenic
1098040158 12:66345978-66346000 ACACACATTTCCAATGCTAAAGG + Exonic
1100213322 12:92421038-92421060 ACACACTTGGGCAATGATGATGG - Exonic
1103571758 12:121849596-121849618 ACACACATGCGCAGTGGACATGG + Intronic
1103985145 12:124762033-124762055 ACACACATGCACGAAGCTGGGGG - Intergenic
1104422286 12:128646028-128646050 ACACTCATATCCAATGCTGATGG - Intronic
1104422295 12:128646162-128646184 ACACTCATATCCAATGCTGATGG - Intronic
1104422327 12:128646547-128646569 ACACTCATATCCAATGCTGATGG - Intronic
1104422343 12:128646751-128646773 ACACTCATATCCAATGCTGATGG - Intronic
1104422397 12:128647365-128647387 ACACTCATATCCAATGCTGATGG - Intronic
1104422406 12:128647464-128647486 ACACTCATATCCAATGCTGATGG - Intronic
1104422490 12:128648473-128648495 ACACTCATATCCAATGCTGATGG - Intronic
1104422525 12:128648881-128648903 ACACCCATATCCAATGCTGATGG - Intronic
1106173614 13:27309491-27309513 AAACACATGGGCAGAGCTGATGG + Intergenic
1106485157 13:30166031-30166053 ATTCACATCCGCAATGCTGACGG + Intergenic
1110453965 13:75669232-75669254 ACACACACTCACAATGCAGAGGG - Intronic
1120015502 14:79468667-79468689 TCAGACATGCGCACTGCTGTGGG - Intronic
1120854733 14:89202749-89202771 CCACTCATGCGAAATGCGGAGGG - Intronic
1123150695 14:106178830-106178852 ACACTCATCTTCAATGCTGATGG + Intergenic
1130210999 15:81921618-81921640 ACACACACACACAACGCTGAGGG + Intergenic
1131668232 15:94592656-94592678 ACACACAGGCACAAGACTGAGGG + Intergenic
1131929539 15:97425286-97425308 AGACACATGGGCTACGCTGATGG + Intergenic
1133662004 16:7927491-7927513 GCTCACTTGCCCAATGCTGACGG + Intergenic
1135553684 16:23418048-23418070 GCACTCATGGGCAATGCTGCAGG - Intronic
1138281953 16:55779101-55779123 ACAGAAATGTGCAAAGCTGAAGG - Intergenic
1138286920 16:55817288-55817310 ACAGAGATGTGCAAAGCTGAAGG + Intronic
1138789291 16:59883688-59883710 GCACACATCGGCAAAGCTGATGG - Intergenic
1144425191 17:15134819-15134841 AAACACAAGTGCAATGCTAAAGG + Intergenic
1149247288 17:54725346-54725368 ATACAGATGAGCAAAGCTGAAGG + Intergenic
1155711860 18:28890996-28891018 ACACACAGGGACAGTGCTGAAGG + Intergenic
1159619582 18:70621879-70621901 ACACACATGCTGCATGCTGCAGG + Intergenic
925016218 2:526106-526128 ACATACATCCGCATTGCTGTGGG - Intergenic
925862433 2:8192785-8192807 AAACACAAGCACAATGCTGAGGG + Intergenic
932667917 2:73711713-73711735 TCAAACATGCTGAATGCTGAGGG + Intergenic
941708774 2:168689074-168689096 ACACACATGCCCAATGGTCTTGG + Intronic
943641170 2:190359721-190359743 ACACACAAGCACAATGCTAAAGG - Intronic
946749277 2:222877063-222877085 ACACACATGGGGAATGCTTGGGG + Intronic
947005564 2:225507381-225507403 ACACACAACATCAATGCTGATGG + Intronic
1176204196 20:63879259-63879281 CCACACCCGAGCAATGCTGAGGG + Intronic
1179654147 21:42834754-42834776 ACATACACACGCACTGCTGAAGG - Intergenic
1184269700 22:43372247-43372269 ACCCCCAAGCGCAGTGCTGAAGG - Intergenic
1184806699 22:46799301-46799323 ACACACATGCAGAATGGTAATGG - Intronic
955632732 3:60991920-60991942 ACAGAGATGCTCTATGCTGATGG - Intronic
961175802 3:124834278-124834300 ACACTGATGTGGAATGCTGATGG + Intronic
963487229 3:145950586-145950608 ACACACATGCAATATGCAGAAGG + Intergenic
965280909 3:166751481-166751503 AAAGACATGTCCAATGCTGAAGG + Intergenic
970824175 4:20253079-20253101 ACACACATGCACTTCGCTGAAGG - Intergenic
971995675 4:33960931-33960953 ACACACACGCAGTATGCTGATGG + Intergenic
972297986 4:37758349-37758371 ACAAACTTGCTCAATGCTGATGG - Intergenic
973947836 4:55977999-55978021 ACACACATGCGCAATGCTGAAGG - Intronic
978403104 4:108351159-108351181 ACACACATACACAATACTCATGG - Intergenic
982865308 4:160502838-160502860 ACACACATACACAATGTTGGAGG + Intergenic
984123095 4:175770596-175770618 TAGCACATGTGCAATGCTGAAGG - Intronic
986056712 5:4144498-4144520 ACATGCATGCGGAATTCTGACGG + Intergenic
986056729 5:4144738-4144760 ATGCACATGCACAATGCCGATGG + Intergenic
986157579 5:5191760-5191782 AGACTCATGGGCAATGGTGAAGG - Exonic
999206858 5:149855017-149855039 ACACACATGGGCAAAGCTGTGGG - Exonic
1000612802 5:163393352-163393374 ACACACATACACAAAGCTGGAGG + Intergenic
1002913521 6:1509946-1509968 ACACACAGACGCAGTGCTAAAGG - Intergenic
1003483178 6:6552043-6552065 ACACACATGCCCAAATCTCAAGG - Intergenic
1004351875 6:14897271-14897293 ACACACATGCACAATGGTTTAGG + Intergenic
1004868675 6:19880350-19880372 AGAAACATGAGCACTGCTGATGG - Intergenic
1008485836 6:52034557-52034579 ACACACGTGCACAATGATGGTGG + Intronic
1009590300 6:65660695-65660717 ACAGACATATGCAATGCTTACGG + Intronic
1014152821 6:118078405-118078427 ACACACATGGGAAATGATGAAGG + Intronic
1014469387 6:121796692-121796714 ACACCCATGCACATTGGTGAAGG - Intergenic
1014533296 6:122586669-122586691 ACACACATGCGAAATAAAGAAGG - Intronic
1019645151 7:2124967-2124989 ACACACATGGGCATGGCTGAGGG + Intronic
1020244028 7:6416835-6416857 TCTCACAGGAGCAATGCTGAAGG + Exonic
1023556946 7:41433309-41433331 ACACACACACACAAAGCTGAAGG - Intergenic
1024444152 7:49456572-49456594 ACACACATACACATTGCAGATGG - Intergenic
1026080193 7:67211141-67211163 ACACACACACACAATGTTGATGG - Intronic
1026696895 7:72602874-72602896 ACACACACACACAATGTTGATGG + Intronic
1027437132 7:78175886-78175908 AGACACATGAACAATCCTGAAGG + Intronic
1027456563 7:78399308-78399330 ACACACATACAAAATGCTTAAGG + Intronic
1029104475 7:98164154-98164176 CCACAGATTTGCAATGCTGACGG + Intronic
1031488846 7:122363390-122363412 ACACACATGTGTGTTGCTGAGGG + Intronic
1033393048 7:140947161-140947183 TCACACATAGGCAATGCTCAGGG + Intergenic
1034566271 7:151918183-151918205 ACACCCATTCCCAATGCTGGTGG + Intergenic
1035249046 7:157585115-157585137 ACACACGTCAGCAGTGCTGATGG + Intronic
1035338165 7:158143382-158143404 ACAGCCATGCCCAATGCCGAGGG - Intronic
1038899316 8:31824501-31824523 ACATTCATACGCATTGCTGATGG + Intronic
1040567309 8:48579327-48579349 ACCCACATGGGCAGGGCTGATGG + Intergenic
1041396465 8:57396679-57396701 ACAGACGTGCCCAGTGCTGAAGG + Intergenic
1041663435 8:60420841-60420863 ACCCACATGCGCAAATCTCAGGG - Intergenic
1041684664 8:60632357-60632379 ACACACATGCACAATGTCTATGG - Intergenic
1043382523 8:79718957-79718979 ACACACTTTAGCAATGCTGGAGG + Intergenic
1046742795 8:117846645-117846667 ACACACAGGCCCAATGGTGATGG + Intronic
1048106397 8:131415060-131415082 ACACCCATTCACATTGCTGAAGG + Intergenic
1050015915 9:1234587-1234609 ACCTAAATGCCCAATGCTGAAGG - Intergenic
1050727879 9:8673216-8673238 ACACACATACGCACAGCTAAAGG + Intronic
1052631540 9:31047664-31047686 ACAAACCTGTGGAATGCTGAGGG + Intergenic
1053265336 9:36708939-36708961 ACACACCTGCAGAATGCAGATGG - Intergenic
1188737132 X:33731161-33731183 ACACACACGCACACTCCTGATGG - Intergenic
1189074304 X:37900130-37900152 ACACACACACACAATGGTGAGGG + Intronic
1190219720 X:48504028-48504050 ACGCACATGCGCATTTCTGAAGG + Intergenic
1192735060 X:73842977-73842999 ACACACTGGCGCAATGCAAAAGG + Intergenic
1193442366 X:81558225-81558247 ACAAACATACGCAATGCAAAAGG + Intergenic
1201529598 Y:14977433-14977455 ACAAACAGGGGCAATGCTCAAGG + Intergenic
1201637185 Y:16136772-16136794 ACACACTTTTGTAATGCTGATGG + Intergenic