ID: 973947837

View in Genome Browser
Species Human (GRCh38)
Location 4:55978022-55978044
Sequence GCATGTGCATGTGTGTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2582
Summary {0: 1, 1: 7, 2: 63, 3: 318, 4: 2193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973947833_973947837 13 Left 973947833 4:55977986-55978008 CCTGCCCTTACAGCCTTCAGCAT 0: 1
1: 0
2: 1
3: 15
4: 200
Right 973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG 0: 1
1: 7
2: 63
3: 318
4: 2193
973947834_973947837 9 Left 973947834 4:55977990-55978012 CCCTTACAGCCTTCAGCATTGCG 0: 1
1: 0
2: 0
3: 9
4: 175
Right 973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG 0: 1
1: 7
2: 63
3: 318
4: 2193
973947836_973947837 0 Left 973947836 4:55977999-55978021 CCTTCAGCATTGCGCATGTGTGT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG 0: 1
1: 7
2: 63
3: 318
4: 2193
973947835_973947837 8 Left 973947835 4:55977991-55978013 CCTTACAGCCTTCAGCATTGCGC 0: 1
1: 0
2: 0
3: 8
4: 85
Right 973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG 0: 1
1: 7
2: 63
3: 318
4: 2193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973947837 Original CRISPR GCATGTGCATGTGTGTGTTT AGG Intronic
Too many off-targets to display for this crispr