ID: 973948132

View in Genome Browser
Species Human (GRCh38)
Location 4:55981664-55981686
Sequence TTAAGCAGAAGTTTCTCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973948129_973948132 -10 Left 973948129 4:55981651-55981673 CCAATCCCTGAACTTAAGCAGAA 0: 1
1: 0
2: 1
3: 16
4: 181
Right 973948132 4:55981664-55981686 TTAAGCAGAAGTTTCTCATATGG No data
973948128_973948132 27 Left 973948128 4:55981614-55981636 CCTAAAATATTTACTGTTTTTTT 0: 1
1: 5
2: 36
3: 374
4: 3148
Right 973948132 4:55981664-55981686 TTAAGCAGAAGTTTCTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973948132 Original CRISPR TTAAGCAGAAGTTTCTCATA TGG Intronic
No off target data available for this crispr