ID: 973949174

View in Genome Browser
Species Human (GRCh38)
Location 4:55993938-55993960
Sequence CCATATCCCCAGGTTATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973949174 Original CRISPR CCATATCCCCAGGTTATACA AGG (reversed) Intronic
911190117 1:94940150-94940172 CCAAATCCCCATGTTGTTCATGG + Intergenic
915069296 1:153252875-153252897 CCATATCCCCATGTAACTCAGGG - Intergenic
915980557 1:160417320-160417342 CCATATCCCCAGGCTGTCCCAGG + Intronic
1062887190 10:1025882-1025904 CTACATCCCCAGGGTATAAAAGG - Intergenic
1068707358 10:60091636-60091658 CAATTTCCGCAGGTTATACAGGG - Intronic
1070847912 10:79538980-79539002 CTATACCCCCAGGATCTACAAGG - Intergenic
1070925869 10:80221163-80221185 CTATACCCCCAGGATCTACAAGG + Intergenic
1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG + Intronic
1074447834 10:113534793-113534815 CCATATCCCCATTTTACAGATGG - Intergenic
1075217797 10:120553806-120553828 CCATGTCCCCAGGTTACTCAGGG + Intronic
1081173672 11:39899444-39899466 CCATAGCCGCGGGTTCTACATGG - Intergenic
1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG + Intronic
1086234366 11:84610438-84610460 TCATATCACCAGGTCATAAAAGG + Intronic
1087155236 11:94895490-94895512 CCATTCCCCCAAGTCATACAGGG + Intergenic
1088953574 11:114595492-114595514 CCAGATCCCTAGTTTATACATGG + Intronic
1093258164 12:16898758-16898780 CCTAATCCCCACGTTATTCAAGG + Intergenic
1097632222 12:62078332-62078354 CCATCTCCCAAGGTTACAAAAGG + Intronic
1098009630 12:66036709-66036731 CAAGATCTCCAGGTTATTCATGG - Intergenic
1102220497 12:111191156-111191178 CATTATCCCCATTTTATACATGG - Intronic
1102226137 12:111229555-111229577 CCATCCCCCCAGGATAAACAAGG - Intronic
1102775342 12:115513890-115513912 CCAGACCCCCAGATTATCCAAGG + Intergenic
1108919991 13:55661433-55661455 CCATATCACCAGTTTCTTCATGG - Intergenic
1112364667 13:98746756-98746778 CCATATCCCCACATCATACCTGG + Intronic
1112580134 13:100671485-100671507 CCACAGCCCCAGGATATATAAGG + Intronic
1116960834 14:50966702-50966724 TCATATCCGCAGGTTCCACATGG - Intergenic
1122305527 14:100763775-100763797 CCAAACCCCCATGTTATTCAAGG - Intergenic
1124368337 15:29089488-29089510 CCAGACCCCCAGGATATACAGGG + Intronic
1124849693 15:33324310-33324332 CCATTTCCCCAGAAGATACAGGG - Intronic
1124861100 15:33442618-33442640 CCATATCAGCAGGTTGCACATGG + Intronic
1126271926 15:46829293-46829315 CCATATCCCCAGTTTGTTCCAGG - Intergenic
1131848014 15:96508795-96508817 TCAGATTCCCAGGTGATACAGGG - Intergenic
1131921926 15:97337560-97337582 CCATATCTATAGGTTCTACAAGG - Intergenic
1132024984 15:98397665-98397687 CCATTTCCCCAGCTTGGACAAGG - Intergenic
1135300815 16:21325459-21325481 CCATATGACCAGCTTATACTTGG - Intergenic
1136479164 16:30530952-30530974 CTGTATCCCCAAGTTCTACACGG - Intronic
1139311003 16:66028060-66028082 TCATCTCTCCAGGTTAAACAAGG - Intergenic
1143323808 17:6085465-6085487 CCGTATCCCCATTTTATAGATGG + Intronic
1143594525 17:7906434-7906456 CCAAATCCCCAGGTGCTCCAGGG - Intronic
1147141196 17:38461453-38461475 CCAGGCCCCCAGGTTATTCAAGG + Intronic
1151782992 17:76259778-76259800 GCATATCCCCAGTTAATAAAAGG - Intergenic
1153216114 18:2822435-2822457 CCATAATGGCAGGTTATACATGG - Intergenic
1166944236 19:46387354-46387376 CCATCTCCCCAGATCATGCACGG + Exonic
925269827 2:2596296-2596318 CCTTATCCCCAGTTTTTAAAGGG - Intergenic
929475011 2:42237526-42237548 CCAAACCCCCATGTTATTCAAGG - Intronic
933041182 2:77468805-77468827 CCATATCCCTAAGTTCCACATGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936226180 2:110654939-110654961 CCATATCCACAAGTTCTGCAGGG + Intronic
938741859 2:134239682-134239704 CCTCATCCCCAGGACATACATGG - Intronic
941437801 2:165493033-165493055 TCATATCCCCAGCTTATAGATGG - Intronic
943186822 2:184618528-184618550 CCATATCCATAGGTTTCACAGGG + Intronic
1168863125 20:1060407-1060429 CCATCTCCCCAAGTTTTCCAGGG - Intergenic
1169818475 20:9683582-9683604 CTATATGCCCAGGATAAACAGGG - Intronic
1172758551 20:37305770-37305792 AAATGGCCCCAGGTTATACAGGG + Intronic
1173964910 20:47105294-47105316 CCATCTCCCCATTTTCTACATGG + Intronic
1181939182 22:26462267-26462289 CCATATCCCCTGGTTTGTCAAGG - Intronic
1182413160 22:30204214-30204236 CCATAGCCCCAGGTCACCCACGG + Intergenic
1182781258 22:32869844-32869866 CCATCTCCCCATTTTATAGATGG + Intronic
1184631869 22:45787994-45788016 GCTGATCCCAAGGTTATACAAGG + Intronic
951439085 3:22702085-22702107 CCATTTCCCTGGGTTATAAAGGG - Intergenic
952488401 3:33840028-33840050 CCATAACCCCATGTTGTTCAGGG - Intronic
957152981 3:76510360-76510382 CCATTTCCTCAGGTTGTATATGG - Intronic
958455525 3:94326535-94326557 TCATATCCCCATTTTATAGATGG + Intergenic
959484907 3:106916168-106916190 GCATGTCCCCAGGTAATACATGG - Intergenic
962962490 3:140323347-140323369 CCTCTTCCACAGGTTATACAAGG + Intronic
964022602 3:152032083-152032105 CCATACACCCATGTAATACAAGG - Intergenic
965952201 3:174323544-174323566 GCATTTCCCCAGGTAAGACAAGG + Intergenic
970564283 4:17316239-17316261 TCATATTCCCAGGTTCCACATGG + Intergenic
973949174 4:55993938-55993960 CCATATCCCCAGGTTATACAAGG - Intronic
974625918 4:64429074-64429096 CAGTGTCCCAAGGTTATACAGGG - Intergenic
977487571 4:97667688-97667710 CAAAATACCCAGGTTATACTTGG - Intronic
978167881 4:105630768-105630790 CTTTATCCCCAGGTTATTCAGGG - Intronic
978173396 4:105701598-105701620 CCATTCCCCCAGCATATACAAGG + Intronic
982005957 4:151063053-151063075 CCATATCCACGGGTTCCACATGG + Intergenic
983529031 4:168791008-168791030 CCATATCCCTATGTTATAACAGG + Intronic
983589280 4:169389824-169389846 CCAAATCCCCAAGTTGTTCAAGG - Intergenic
983744429 4:171178566-171178588 TCATATCCACAGGTTCTACGTGG + Intergenic
984093435 4:175404294-175404316 CAATAACCCCAGGTTTCACATGG + Intergenic
998769965 5:145531651-145531673 CCATTTCCCCAGGCTCTGCAAGG + Intronic
999000107 5:147911448-147911470 CCATTTCCTCATTTTATACAAGG + Intergenic
999316354 5:150586451-150586473 CCATATCTCCAGTTTATAGTGGG - Intergenic
999441099 5:151601525-151601547 CCTTATCCCCAGGTTCTGCGAGG - Intergenic
1001058653 5:168469943-168469965 CCACATCCCCAAGTTAGACTGGG + Intronic
1001424339 5:171613625-171613647 TCTTATCCCCAGGTTACAAATGG + Intergenic
1003245783 6:4380948-4380970 CCAGATCCCCATGTTGTACTGGG - Intergenic
1006236913 6:32641693-32641715 ACATATTCCCATGTAATACAAGG + Intronic
1006246915 6:32745542-32745564 ACATATTCCCATGTAATACAAGG + Intronic
1006473216 6:34239667-34239689 CCTTATCCCCAGGCTACAGATGG - Intronic
1007041301 6:38724918-38724940 CCATATCCCCTGCTTTTATAGGG + Intronic
1010760470 6:79716687-79716709 CAAGATCCCCAGGTGATTCAGGG + Intergenic
1011348768 6:86399978-86400000 CCATGTCCCAAGGTTGTGCAGGG + Intergenic
1011635183 6:89365756-89365778 TCATATACCCAGCTTAAACATGG + Exonic
1012631269 6:101470606-101470628 CCCCATCCCCAGGATATAAAAGG - Intronic
1012875387 6:104720519-104720541 CCATATCCGCAGGTTCCACAGGG - Intergenic
1014649788 6:124021861-124021883 CCAAATGCCTAGGTTTTACATGG - Intronic
1018773510 6:166993151-166993173 TCATATCCACAGGTTCCACAGGG + Intergenic
1026661765 7:72309005-72309027 CCTTATCCCCATTTTATAGATGG + Intronic
1029568238 7:101353858-101353880 CCATATCCCCATTTTACAGATGG - Intergenic
1030050697 7:105534604-105534626 CTATATCTCAAGGTTATAAATGG - Intronic
1031149098 7:118032134-118032156 CTATATACCCAAGTAATACAAGG - Intergenic
1032715037 7:134500885-134500907 TCTTCTCCCCAGGTAATACATGG - Intergenic
1036071781 8:5448584-5448606 ACATATCCCCAGGCTGGACATGG - Intergenic
1037844549 8:22271587-22271609 CCATCTCCCTAGTTTATAGATGG + Intergenic
1038217519 8:25576508-25576530 CCTGAACCCCAGGTTACACAAGG - Intergenic
1040677676 8:49770336-49770358 CAATATACCCAGGCTACACATGG + Intergenic
1043660154 8:82728898-82728920 TAATATCCAAAGGTTATACATGG - Intergenic
1055318277 9:75055882-75055904 CCATTTCATCAGGTTATCCATGG - Intergenic
1056106192 9:83349091-83349113 ACATGTGCCCAGGTTATTCAAGG + Intronic
1059343902 9:113615561-113615583 CCTGCTCCCCAGGTTAAACATGG - Intergenic
1188352777 X:29152255-29152277 CCATAATCCCATGTTATGCATGG - Intronic
1192955349 X:76064084-76064106 CCATGTCCCAAGGCTACACAGGG + Intergenic
1194409860 X:93544121-93544143 CAGTATCCCGAGGTTACACAGGG + Intergenic