ID: 973950425

View in Genome Browser
Species Human (GRCh38)
Location 4:56007449-56007471
Sequence GTTCAGTAACAACATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973950425_973950429 2 Left 973950425 4:56007449-56007471 CCTACAGCATGTTGTTACTGAAC 0: 1
1: 1
2: 0
3: 25
4: 171
Right 973950429 4:56007474-56007496 CCACTCTGATTGGGTGTCTTTGG 0: 1
1: 0
2: 3
3: 7
4: 184
973950425_973950431 29 Left 973950425 4:56007449-56007471 CCTACAGCATGTTGTTACTGAAC 0: 1
1: 1
2: 0
3: 25
4: 171
Right 973950431 4:56007501-56007523 GTAATAGAGAAGAGTTTCCAGGG No data
973950425_973950426 -8 Left 973950425 4:56007449-56007471 CCTACAGCATGTTGTTACTGAAC 0: 1
1: 1
2: 0
3: 25
4: 171
Right 973950426 4:56007464-56007486 TACTGAACTACCACTCTGATTGG No data
973950425_973950427 -7 Left 973950425 4:56007449-56007471 CCTACAGCATGTTGTTACTGAAC 0: 1
1: 1
2: 0
3: 25
4: 171
Right 973950427 4:56007465-56007487 ACTGAACTACCACTCTGATTGGG 0: 1
1: 0
2: 10
3: 45
4: 165
973950425_973950430 28 Left 973950425 4:56007449-56007471 CCTACAGCATGTTGTTACTGAAC 0: 1
1: 1
2: 0
3: 25
4: 171
Right 973950430 4:56007500-56007522 AGTAATAGAGAAGAGTTTCCAGG 0: 1
1: 1
2: 3
3: 49
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973950425 Original CRISPR GTTCAGTAACAACATGCTGT AGG (reversed) Intronic
900559837 1:3298658-3298680 GTTCAGTGCCAACATTCTGGTGG + Intronic
902810356 1:18884733-18884755 ATGCAGGAACAACATGCTCTGGG + Intronic
904472233 1:30742989-30743011 CTTCTGTAACAACAAGCTCTGGG + Intronic
907933720 1:59023173-59023195 TTTCAATACCAACATGCAGTGGG + Intergenic
909396269 1:75174195-75174217 TTTCAGTAACACCATTCTTTTGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
918430816 1:184458799-184458821 GTTTAGTAACAAAATGGTGAAGG + Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1063827890 10:9919678-9919700 CTTCAGAAAAAGCATGCTGTTGG + Intergenic
1064715863 10:18176025-18176047 GTCTAGTTACAACATGCTGTAGG - Intronic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1071951973 10:90713524-90713546 GTTCAGTAAAAATATAATGTTGG - Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1073140988 10:101247581-101247603 CTTCAGTAACCCCATGCTGGGGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1079438908 11:20488582-20488604 CTGCTGTAACCACATGCTGTTGG + Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1081560998 11:44216458-44216480 CTTCAATTTCAACATGCTGTTGG - Intronic
1084012191 11:66358239-66358261 GTGCAGTCACAACTTGCTGCAGG + Intronic
1084511083 11:69604506-69604528 TTTCTGCAATAACATGCTGTGGG + Intergenic
1087305350 11:96483010-96483032 ATTCACTGACAACCTGCTGTGGG - Intronic
1088514957 11:110622185-110622207 GTACAGTTACATCATGGTGTAGG - Intronic
1088848139 11:113684514-113684536 CTTCTGTAACAACAGGCTCTTGG + Intergenic
1091893931 12:4084911-4084933 GTGCAGTGCCAAAATGCTGTGGG + Intergenic
1091978818 12:4849170-4849192 ATTCCCTAAGAACATGCTGTAGG + Intronic
1092671570 12:10867713-10867735 GTTCAATAGCACCATGCTTTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1098471995 12:70855990-70856012 GTGGAGTAAAAAAATGCTGTGGG - Intronic
1102619455 12:114182507-114182529 GGTCAGCACCAACTTGCTGTAGG + Intergenic
1104446803 12:128840803-128840825 TTTCAGTAGCAACCTGTTGTGGG - Intergenic
1104766182 12:131331540-131331562 GTTCACTGAGCACATGCTGTGGG + Intergenic
1104813273 12:131631313-131631335 GTTCACTGAGCACATGCTGTGGG - Intergenic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1106992024 13:35431148-35431170 ATTTAGTAAAAACATACTGTGGG + Intronic
1108245716 13:48511195-48511217 GGTCAGTAAAAAAATGCTATAGG - Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1112556256 13:100471423-100471445 GTGAAGTAAGCACATGCTGTTGG + Intronic
1121695949 14:95912201-95912223 GTTTAGGAAAAACATGCTGGGGG - Intergenic
1123913252 15:24991994-24992016 ATTCAGTAACACAATCCTGTCGG - Intergenic
1126269184 15:46792879-46792901 GTTCAGTAACACTATGCTGCAGG + Intergenic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1128656652 15:69467635-69467657 GTTCTGTTTCAACAAGCTGTGGG + Intergenic
1128964884 15:72048834-72048856 ATTCATGAACACCATGCTGTTGG + Intronic
1130857475 15:87853704-87853726 GTACTATAACAACAGGCTGTAGG + Intergenic
1140466687 16:75188730-75188752 GTGCAGGAACGACATGCTGCTGG - Intergenic
1140580463 16:76225196-76225218 GTTAAGTAACCCTATGCTGTAGG - Intergenic
1141783482 16:86181599-86181621 GTTCAGCAACAGCAGGCTGAGGG - Intergenic
1143807619 17:9442295-9442317 GTTCAGTCATGACATGATGTTGG - Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1151147715 17:72056946-72056968 CTTGGGTACCAACATGCTGTAGG + Intergenic
1151516544 17:74599836-74599858 GTTCAGTTACAAGTTGCTGGAGG + Intergenic
1152761957 17:82113306-82113328 CTTCAGTGACAAGGTGCTGTGGG + Intronic
1157520964 18:48345220-48345242 GTTCAGTAAGAAGCTGCAGTAGG + Intronic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1160202046 18:76804054-76804076 TTGCAATGACAACATGCTGTGGG - Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1163253923 19:16143515-16143537 GCTCAATAACAACTTGCTGGGGG + Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166402664 19:42495147-42495169 GTTCAGTTACAAATTGCTGCTGG - Intergenic
1166974736 19:46599313-46599335 GTTCGTTAGCACCATGCTGTGGG - Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927761435 2:25758905-25758927 GTCCAGTATCAACAGGATGTGGG - Intronic
927904218 2:26845982-26846004 GTTCAATAACCACTTTCTGTGGG + Intergenic
932990721 2:76782529-76782551 GTACAGTAATAAATTGCTGTTGG + Intronic
933358401 2:81244656-81244678 GTTCAGTAACAAAATCTAGTAGG + Intergenic
934931952 2:98433812-98433834 GCTCAGGAACCACATGCTCTTGG + Intergenic
940788170 2:158003989-158004011 CTTCAATAACACCATGTTGTTGG - Intronic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943602563 2:189939210-189939232 TTTCAGTGGCACCATGCTGTAGG + Intronic
944195266 2:197046515-197046537 GTTCTGTAACAACAGGCTCCTGG - Intronic
944999078 2:205329599-205329621 GTTAAGAAGCAACATGCGGTAGG + Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1171425335 20:25045249-25045271 GTTCAGTACCATCCTGCTGCTGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1175033066 20:55974323-55974345 GTTCAGTAACAATAGGGTTTGGG + Intergenic
1176669897 21:9723403-9723425 GCTCAGCAAGAAAATGCTGTTGG + Intergenic
1177759378 21:25385867-25385889 GTTCACTAACATCATACTGTAGG + Intergenic
1178582925 21:33851092-33851114 GTTCAGAAACAACATGTGGAAGG - Intronic
1180121419 21:45751069-45751091 GTTTAGTGACATCATGCGGTAGG + Intronic
1181429397 22:22869155-22869177 GTTCTTTAACAACAGCCTGTGGG + Intronic
949813153 3:8029728-8029750 GCTCAGTAACAACATGTGGCTGG - Intergenic
952425797 3:33173669-33173691 GTTCAGTAACATCATGGTGCTGG + Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
953326815 3:42018526-42018548 GTTAAATAAGACCATGCTGTGGG + Intronic
953578276 3:44130408-44130430 GTCCCCTAACAACCTGCTGTGGG - Intergenic
954457809 3:50609467-50609489 GTTCAGTAACACCATATTCTTGG + Intronic
954961103 3:54565701-54565723 GTTGAATAACATAATGCTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
958885326 3:99720199-99720221 GTTCAGTCATAATATGGTGTTGG - Intronic
961101678 3:124204361-124204383 GTTTAGGAACAAACTGCTGTGGG + Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
967475766 3:189915563-189915585 GTGCATAAACCACATGCTGTAGG - Intergenic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
969392305 4:6900051-6900073 GTCCATTAAAAAAATGCTGTGGG + Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970202939 4:13627676-13627698 GTTCCGTAACAACATCCCGTTGG - Exonic
970307786 4:14751121-14751143 ATTCAGTGACATCATGCTGATGG + Intergenic
972168549 4:36316716-36316738 AGTTAGCAACAACATGCTGTGGG - Intronic
973950425 4:56007449-56007471 GTTCAGTAACAACATGCTGTAGG - Intronic
974964063 4:68738235-68738257 GCTTAGCAACAGCATGCTGTAGG - Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
980500203 4:133641143-133641165 ATTCAGAAAAAACATGTTGTGGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
984980664 4:185277539-185277561 GTTCAGTGACGTCATGCTGGTGG - Intronic
985347861 4:189025741-189025763 GGACATTAACACCATGCTGTGGG + Intergenic
985404885 4:189628128-189628150 GCTCAGCAAGAAAATGCTGTTGG - Intergenic
986842960 5:11719141-11719163 GTTCAGTAAGAAAATGCTGGAGG + Intronic
992672427 5:79073783-79073805 GCACAGTAAAAAGATGCTGTAGG + Intronic
995171917 5:109124312-109124334 TTTCATTAACTAAATGCTGTGGG + Intronic
995181260 5:109232695-109232717 GCTCAGTATCAACAGTCTGTAGG + Intergenic
995553124 5:113300016-113300038 GTGCACCAACACCATGCTGTGGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
996547440 5:124695287-124695309 TTTCAGTAACAGCATGGAGTTGG - Intronic
997714449 5:136031551-136031573 GTTCAGACACAGAATGCTGTTGG + Intronic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999813714 5:155154232-155154254 GTTGAGTAACAACAAATTGTAGG + Intergenic
1005887715 6:30109496-30109518 GTTCAGTAGCCACATGTGGTTGG - Intronic
1006086665 6:31600522-31600544 CTTCTTTAACAACAAGCTGTGGG + Intergenic
1006737373 6:36284054-36284076 GATCAGTAAGAACCTGCAGTGGG + Intronic
1007256466 6:40532834-40532856 GTTCAGTACCCACCTGCTGGGGG - Intronic
1007917528 6:45575055-45575077 ATTGAGTTACAACATCCTGTGGG + Intronic
1011897885 6:92254539-92254561 ATTCAGTAACATCATACTGGTGG - Intergenic
1011980048 6:93363211-93363233 GTTCAGAACCAACATCCTGGAGG + Intronic
1012121236 6:95369718-95369740 GCTCAATAACCACATGCTGCCGG + Intergenic
1015580675 6:134721165-134721187 GACCAGTAAACACATGCTGTGGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1019007103 6:168808181-168808203 GCTCAGTGTCCACATGCTGTAGG - Intergenic
1022346290 7:29517820-29517842 GTGCAGAAAGAACATGCTGAAGG + Intergenic
1023555367 7:41416762-41416784 GTTCAATCACAATAAGCTGTAGG + Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1033942717 7:146675975-146675997 GTTCAGTCACATAATGTTGTTGG + Intronic
1035435364 7:158855666-158855688 GGTCAGAAGCAAGATGCTGTGGG + Intergenic
1036639081 8:10571018-10571040 ATGAAGTAAGAACATGCTGTTGG - Intergenic
1037121909 8:15298712-15298734 GTTCTGTAACTACATTCAGTAGG + Intergenic
1037758253 8:21725314-21725336 GGTCAGCAACAGCATGCTGAAGG + Intronic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1042778666 8:72465758-72465780 GTTCACTAAAGACATGGTGTAGG - Intergenic
1048000129 8:130372514-130372536 GTACTGTATCAACCTGCTGTTGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052425220 9:28295570-28295592 GATCAATAACAACATGCAGAGGG - Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1053560769 9:39191706-39191728 CTTCTGTAAACACATGCTGTTGG - Intronic
1053570753 9:39303362-39303384 GTTCAGAAAGAAAATGATGTAGG + Intergenic
1053824870 9:42011956-42011978 CTTCTGTAAACACATGCTGTTGG - Intronic
1053836697 9:42144280-42144302 GTTCAGAAAGAAAATGATGTAGG + Intergenic
1054092374 9:60862381-60862403 GTTCAGAAAGAAAATGATGTAGG + Intergenic
1054113788 9:61137974-61137996 GTTCAGAAAGAAAATGATGTAGG + Intergenic
1054126392 9:61315650-61315672 GTTCAGAAAGAAAATGATGTAGG - Intergenic
1054136350 9:61427249-61427271 CTTCTGTAAACACATGCTGTTGG + Intergenic
1054593909 9:67044215-67044237 GTTCAGAAAGAAAATGATGTAGG - Intergenic
1054605702 9:67175407-67175429 CTTCTGTAAACACATGCTGTTGG + Intergenic
1054836804 9:69683914-69683936 GTTAAGGAATAACATGTTGTGGG + Intergenic
1055874578 9:80926697-80926719 GTTCATTGTCAAAATGCTGTGGG - Intergenic
1056953230 9:91062413-91062435 CTTCAGGAAAGACATGCTGTTGG - Intergenic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1057439393 9:95072037-95072059 GTTCAGTGACATCATGTTGGTGG + Intronic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1062537023 9:137025544-137025566 GGCCAGGAACATCATGCTGTGGG + Intronic
1188237978 X:27752393-27752415 ATGAAGTAACCACATGCTGTTGG - Intergenic
1188350653 X:29127104-29127126 GTTTTATAACAACCTGCTGTTGG + Intronic
1188605866 X:32028595-32028617 ATTCTGTAGCAAAATGCTGTGGG - Intronic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190179328 X:48178043-48178065 GTCCAGTAAAAACCTGCTCTTGG - Intergenic
1190185379 X:48229005-48229027 GTCCAGTAAAAACCTGCTCTTGG - Intronic
1190190773 X:48275070-48275092 GTCCAGTAAAAACCTGCTCTTGG - Intronic
1190198158 X:48337217-48337239 GTCCAGTAAAAACCTGCTCTTGG - Intergenic
1190280627 X:48926829-48926851 GGGCAGTATCAACATGGTGTGGG + Intronic
1190664918 X:52687678-52687700 GTCCAGTAAAAACCTGCTCTTGG - Intronic
1190674504 X:52770741-52770763 GTCCAGTAAAAACCTGCTCTTGG + Intronic
1192430497 X:71108294-71108316 ATTCAGTAACAAGATCCTCTAGG + Exonic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194096342 X:89644077-89644099 GTTCTGTAAAAAAATGATGTTGG - Intergenic
1194129170 X:90058740-90058762 GTTTAGTATCTACATGGTGTCGG - Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1197473703 X:126894152-126894174 ATTAAGTGACAACATGCTGTTGG - Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic
1200357067 X:155563013-155563035 GTTCAGAAACAAGAAGATGTGGG - Intronic
1200449348 Y:3305450-3305472 GTTCTGTAAAAAAATGATGTTGG - Intergenic