ID: 973954369

View in Genome Browser
Species Human (GRCh38)
Location 4:56048908-56048930
Sequence GGTGCCCAGAAACCAGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954369_973954385 19 Left 973954369 4:56048908-56048930 CCCGCTCCTGGTTTCTGGGCACC No data
Right 973954385 4:56048950-56048972 TGGTGTGCGCCACTCCCGGAGGG No data
973954369_973954384 18 Left 973954369 4:56048908-56048930 CCCGCTCCTGGTTTCTGGGCACC No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954369_973954383 15 Left 973954369 4:56048908-56048930 CCCGCTCCTGGTTTCTGGGCACC No data
Right 973954383 4:56048946-56048968 CATCTGGTGTGCGCCACTCCCGG No data
973954369_973954387 29 Left 973954369 4:56048908-56048930 CCCGCTCCTGGTTTCTGGGCACC No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954369_973954380 -1 Left 973954369 4:56048908-56048930 CCCGCTCCTGGTTTCTGGGCACC No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954369 Original CRISPR GGTGCCCAGAAACCAGGAGC GGG (reversed) Intergenic