ID: 973954370

View in Genome Browser
Species Human (GRCh38)
Location 4:56048909-56048931
Sequence GGGTGCCCAGAAACCAGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954370_973954380 -2 Left 973954370 4:56048909-56048931 CCGCTCCTGGTTTCTGGGCACCC No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954370_973954385 18 Left 973954370 4:56048909-56048931 CCGCTCCTGGTTTCTGGGCACCC No data
Right 973954385 4:56048950-56048972 TGGTGTGCGCCACTCCCGGAGGG No data
973954370_973954387 28 Left 973954370 4:56048909-56048931 CCGCTCCTGGTTTCTGGGCACCC No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954370_973954383 14 Left 973954370 4:56048909-56048931 CCGCTCCTGGTTTCTGGGCACCC No data
Right 973954383 4:56048946-56048968 CATCTGGTGTGCGCCACTCCCGG No data
973954370_973954384 17 Left 973954370 4:56048909-56048931 CCGCTCCTGGTTTCTGGGCACCC No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954370 Original CRISPR GGGTGCCCAGAAACCAGGAG CGG (reversed) Intergenic