ID: 973954372

View in Genome Browser
Species Human (GRCh38)
Location 4:56048914-56048936
Sequence CCCAGGGGTGCCCAGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954372_973954390 30 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954390 4:56048967-56048989 GGAGGGCGCGAGAAGGAAGCCGG No data
973954372_973954384 12 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954372_973954387 23 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954372_973954383 9 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954383 4:56048946-56048968 CATCTGGTGTGCGCCACTCCCGG No data
973954372_973954385 13 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954385 4:56048950-56048972 TGGTGTGCGCCACTCCCGGAGGG No data
973954372_973954380 -7 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954372 Original CRISPR CCCAGGGGTGCCCAGAAACC AGG (reversed) Intergenic