ID: 973954378

View in Genome Browser
Species Human (GRCh38)
Location 4:56048929-56048951
Sequence CAGATGGCTCCCCTCCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954378_973954387 8 Left 973954378 4:56048929-56048951 CCCCTGGGGAGGGGAGCCATCTG No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954378_973954390 15 Left 973954378 4:56048929-56048951 CCCCTGGGGAGGGGAGCCATCTG No data
Right 973954390 4:56048967-56048989 GGAGGGCGCGAGAAGGAAGCCGG No data
973954378_973954385 -2 Left 973954378 4:56048929-56048951 CCCCTGGGGAGGGGAGCCATCTG No data
Right 973954385 4:56048950-56048972 TGGTGTGCGCCACTCCCGGAGGG No data
973954378_973954383 -6 Left 973954378 4:56048929-56048951 CCCCTGGGGAGGGGAGCCATCTG No data
Right 973954383 4:56048946-56048968 CATCTGGTGTGCGCCACTCCCGG No data
973954378_973954384 -3 Left 973954378 4:56048929-56048951 CCCCTGGGGAGGGGAGCCATCTG No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954378 Original CRISPR CAGATGGCTCCCCTCCCCAG GGG (reversed) Intergenic