ID: 973954380

View in Genome Browser
Species Human (GRCh38)
Location 4:56048930-56048952
Sequence CCCTGGGGAGGGGAGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954363_973954380 11 Left 973954363 4:56048896-56048918 CCCTCCTTGGGGCCCGCTCCTGG No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954361_973954380 17 Left 973954361 4:56048890-56048912 CCACGCCCCTCCTTGGGGCCCGC No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954365_973954380 10 Left 973954365 4:56048897-56048919 CCTCCTTGGGGCCCGCTCCTGGT No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954362_973954380 12 Left 973954362 4:56048895-56048917 CCCCTCCTTGGGGCCCGCTCCTG No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954369_973954380 -1 Left 973954369 4:56048908-56048930 CCCGCTCCTGGTTTCTGGGCACC No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954370_973954380 -2 Left 973954370 4:56048909-56048931 CCGCTCCTGGTTTCTGGGCACCC No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954372_973954380 -7 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954360_973954380 18 Left 973954360 4:56048889-56048911 CCCACGCCCCTCCTTGGGGCCCG No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954366_973954380 7 Left 973954366 4:56048900-56048922 CCTTGGGGCCCGCTCCTGGTTTC No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
973954359_973954380 19 Left 973954359 4:56048888-56048910 CCCCACGCCCCTCCTTGGGGCCC No data
Right 973954380 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954380 Original CRISPR CCCTGGGGAGGGGAGCCATC TGG Intergenic