ID: 973954382

View in Genome Browser
Species Human (GRCh38)
Location 4:56048945-56048967
Sequence CGGGAGTGGCGCACACCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954382_973954387 -8 Left 973954382 4:56048945-56048967 CCATCTGGTGTGCGCCACTCCCG No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954382_973954394 24 Left 973954382 4:56048945-56048967 CCATCTGGTGTGCGCCACTCCCG No data
Right 973954394 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
973954382_973954390 -1 Left 973954382 4:56048945-56048967 CCATCTGGTGTGCGCCACTCCCG No data
Right 973954390 4:56048967-56048989 GGAGGGCGCGAGAAGGAAGCCGG No data
973954382_973954392 23 Left 973954382 4:56048945-56048967 CCATCTGGTGTGCGCCACTCCCG No data
Right 973954392 4:56048991-56049013 GCCTCACGCTCAGCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954382 Original CRISPR CGGGAGTGGCGCACACCAGA TGG (reversed) Intergenic