ID: 973954384

View in Genome Browser
Species Human (GRCh38)
Location 4:56048949-56048971
Sequence CTGGTGTGCGCCACTCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954363_973954384 30 Left 973954363 4:56048896-56048918 CCCTCCTTGGGGCCCGCTCCTGG No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954369_973954384 18 Left 973954369 4:56048908-56048930 CCCGCTCCTGGTTTCTGGGCACC No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954381_973954384 -5 Left 973954381 4:56048931-56048953 CCTGGGGAGGGGAGCCATCTGGT No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954372_973954384 12 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954366_973954384 26 Left 973954366 4:56048900-56048922 CCTTGGGGCCCGCTCCTGGTTTC No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954365_973954384 29 Left 973954365 4:56048897-56048919 CCTCCTTGGGGCCCGCTCCTGGT No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954379_973954384 -4 Left 973954379 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954378_973954384 -3 Left 973954378 4:56048929-56048951 CCCCTGGGGAGGGGAGCCATCTG No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data
973954370_973954384 17 Left 973954370 4:56048909-56048931 CCGCTCCTGGTTTCTGGGCACCC No data
Right 973954384 4:56048949-56048971 CTGGTGTGCGCCACTCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954384 Original CRISPR CTGGTGTGCGCCACTCCCGG AGG Intergenic