ID: 973954386

View in Genome Browser
Species Human (GRCh38)
Location 4:56048959-56048981
Sequence CTTCTCGCGCCCTCCGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954386_973954397 23 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954397 4:56049005-56049027 TGTCCCTGGGCGAAGCCGGGCGG No data
973954386_973954399 25 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954399 4:56049007-56049029 TCCCTGGGCGAAGCCGGGCGGGG No data
973954386_973954395 19 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG No data
973954386_973954402 28 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954402 4:56049010-56049032 CTGGGCGAAGCCGGGCGGGGCGG No data
973954386_973954394 10 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954394 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
973954386_973954392 9 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954392 4:56048991-56049013 GCCTCACGCTCAGCTGTCCCTGG No data
973954386_973954396 20 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954396 4:56049002-56049024 AGCTGTCCCTGGGCGAAGCCGGG No data
973954386_973954398 24 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954386 Original CRISPR CTTCTCGCGCCCTCCGGGAG TGG (reversed) Intergenic
No off target data available for this crispr