ID: 973954387

View in Genome Browser
Species Human (GRCh38)
Location 4:56048960-56048982
Sequence CACTCCCGGAGGGCGCGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954381_973954387 6 Left 973954381 4:56048931-56048953 CCTGGGGAGGGGAGCCATCTGGT No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954379_973954387 7 Left 973954379 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954378_973954387 8 Left 973954378 4:56048929-56048951 CCCCTGGGGAGGGGAGCCATCTG No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954372_973954387 23 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954369_973954387 29 Left 973954369 4:56048908-56048930 CCCGCTCCTGGTTTCTGGGCACC No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954382_973954387 -8 Left 973954382 4:56048945-56048967 CCATCTGGTGTGCGCCACTCCCG No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data
973954370_973954387 28 Left 973954370 4:56048909-56048931 CCGCTCCTGGTTTCTGGGCACCC No data
Right 973954387 4:56048960-56048982 CACTCCCGGAGGGCGCGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954387 Original CRISPR CACTCCCGGAGGGCGCGAGA AGG Intergenic